GenePrediction:GLEAN_2698 Details

Name: GLEAN_2698
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2721208..2722961 (+ strand)
Length: 1754
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2721208..2721357 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_140:2721416..2721486 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_140:2721549..2722473 (+ strand)
Length: 925
Type: CDS
Source: GLEAN
Position: GCSC_140:2722527..2722961 (+ strand)
Length: 435
>GLEAN_2698 class=GenePrediction position=GCSC_140:2721208..2722961 (+ strand)
ATGTCGGAAACGGACTACAGCAACAAGGAGTACCGGGTGGAGATCTCGTCGGAGGCCCATGTCTTTGACGCAGAGAAGCC
GCTCCAACGGGGCAGCACCAACGCGGACGAGCGCGACATGGAGATGCTCGGCCGCACGCAGGTGTTGAATGTGTGTGGCA
TCATGTTCTGCAGCGAGCTGTGCGTGACCGTCTGCTGACGATGTCCAGAGAAACTTCCGCTTCCTCTCGACGCTGGGCTT
TGCCTGCACGTTGATGAGCACATGGGAGATTGGCTTGATGTAAGCTCTTGTCTTTCTCTTACTCTTTCTATCTCCCCATC
GCATGACACTGACTCTCCCAGGACGACAGTCTACGGCCTGGCCAACGGCGGCACGGCCGGCCTGATCTGGGGCTACCTGA
TCGTGTGGATGGGCTACATGTTGGTGTTTGCATCGATCGCAGAGATGGCGTCGATCTCGCCGACGGCCGGCGGCCAATAC
CACTGGGTATCGGAGTTTGCACCACCGCGGGCACAAAAGTTCTTCAGCTACATCATCGGCTGGGTGGCCGTGCTGGGCTG
GCAGACCGGACTGGCCTCGCTGGCTTTCCTGGCCGGCACCATGATCCAGGGGCTGCTAGTGTTGACGCAGCCGGACTACG
TGTTTGAAAACTGGCACGGGACACTGCTGGTGATTGCCATCACGGCCTTTTGCATCATCTTCAACACCTTTTTGGCCGGC
CGCCTGCCCATGGTCGAGGGCATGGTGCTGGTCGTCCACGTGCTCGGCTTCTTTGCCGTGCTGATCCCGCTGTGGGTGCT
GGCACCTCGATCCACAGCTGGCGATGTCTTTGGCACGTTTGCGAATCTCGGTGGCTGGAGCTCGACCGGACTCGCCTTCT
TCGTCGGCCTGCTCTCGCCCGTCTACACGCTCATCGGCGCCGACTCGGCCGTGCACATGAGCGAGGAGGTACGCGACGCC
TCGCGTGTGCTGCCGCGTGCCATCATGTGGGCAGCTGTCGTCAACGGCACCATGGGTTGGGTCATGTTGATCACCTTTTG
CTTCACTCTCGGCAATCTGCTCGACGTGCTCGACTCGCCCACCGGCTACCCCTTCATCCAGGTCTTCTACAACGTCACCC
ACAGCATGGCCGGCACCTGTATCATGACCGCTATCCTCATCGTCAACATCACATCTGCCTGCATCAGCACCGTTGCCACC
GTCTCACGTCAGACCTGGTCCTTTGCCCGCGACAATGGCCTGCCTTTTTCTGCCTTTATCGCCCACGTGAGTCTTCTGCT
CTGTTCTCCTCTATTTCGCTCCCGCTCACCCACTCCCAGGTCAAACCCGGCTGGAATATCCCGCTCAACGCCGTTCTCGT
CACCTTTGTCATCACCACCCTCCTCTCGCTCATCAATATCGGCTCTGCCGTGGCCTTTAACGCCATCGGAAGCCTTGCCG
TCACTGCCCTGCTCGGCACCTACCTCATCTCCTTCACCTTCCTCATCATGCATCGCCTCACCGGCTCCGAACTGCCCGGC
CATCGCTGGTCGCTCGGTCGCTGGGGCCTGCCCATCAACCTTGGCTCCGTCCTCTTCTTGATCGTCGTATGGGTCTTTGC
CTTTTTTCCCCAGTACGCCGAGGTCACCAGCGAGACGATGAACTGGAACGTCGTCATCTTTGTCGGCGTCATGGTCTTTG
CCGTCACCTACTACTACATGTACGGTCGCAAGTCGTATATGCCGCCTGTGTCGCTCATGAGGCGGAACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62