GenePrediction:GLEAN_269 Details

Name: GLEAN_269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:672411..674023 (+ strand)
Length: 1613
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:672411..672616 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_167:672711..673023 (+ strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_167:673105..673337 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_167:673408..674023 (+ strand)
Length: 616
>GLEAN_269 class=GenePrediction position=GCSC_167:672411..674023 (+ strand)
ATGGCTCTGTTTGTAGACCTGGACGACGATGACGTCGACCCGTCACAGCACCTCGCTGGCGGCAAGGTGCTCTGGAGCAC
AAACAGCCAGCCATTGGAGACTGACAAGACCCCGGCAATCCCGGCCAATGTCGAGGAGGCTCGCGAGCCTGTTGTCACGG
AGGCTCCGAACTGGAACTCCATGACGGAGGCTTTGGGATGCTATCCGTAGGCAGCTGCACCTTTCCCCTTTTCCCATTGG
CTTTGCTTTTGACATGACCTTTGGCTTTGGCTATACCTTTGGGGGGAATAACTAACCAAGCCGTCGGACGGCCATCAGTA
TCGCTGCCACAATCGCCTCCTTTATTGACCAGAACACGCTCGACAGCCTGGCACGTTCCTGCCGTCAGGTCCGTGCTGCC
CTGCTCCAATTCCGGCGGCCGCTGCTCGCATCAACACTACGATGCACGAACGACGGCATGACTGTCGACGGCGAAGAGAC
GATGCGTTATCGAGCCCGGGCTGGGAATTGGTACTACATGGAGGACACCAGCCGAACTTCGCACGGCAAGGTCGGCCAGT
GTGCGCGTGACATGGTCTCGGAGTGCCGCCGCTGTGGCACTGTCGTCTGCAGGGTGAGCCTTTGTTCTGCTATGACCGAT
GCATGTTGAAGCGTATAGTGGCTGACAGGCGGATCTCCAATCCCCCCCCATCAGAATTGTGCGATCAAGCCACCGGCCGC
TCCTGTTCTGCGTGAACGGCACCGCCGTCTGTGCACGGGTTGTTCCAAGGCGCCACTCATGTCGCTCGCGAAGCCGCCGG
TTGCGGCCGGCACGCCGCTGCAATCCGACCTCATGCGGCGGGCCATCTGCAACTGCGCAACCGAAGGTGTGTGGCTGTGC
CAGCCTTGCGGACGTAGCATCCGCAGTGATGACAGCGAGTATATGGCGTAAGTTTGCCCGATAGGCATCCGGAACACGAC
TGTTGGTCAACAGCAGAGCAGCTCACATGTGCCACAGCATCTGGAAATGGCGGGCGCAATACGGCGATGTGATTGGAGGA
CTCGGCACTGGGGTTGGCGACGGCGACAGAGGAGTAATCTGCGGAAGGAACTCGGAATGCTGTCGTGCAAAGGAGCGAGC
GCAAGAGATCGACTGCGACGCGGAAGACGCACGGGACGCGGAATACTTGGGCCTTGCGTCATCGTTTGGATCGACAGCTG
GTTCGTCGACTGGGTCTCTGAGCTCGCTGGCATCAGCCGCCTCGGCGATTCCAACATCGCCTTGGACGGTGCCAATAGCG
CCGGCAACCCAGGCAGCAGCCACGGTGGGCTCGCCGCTGTACTCTCCCGAGGTGGCGGCAGCGCTGGTGAACCGGCGAAC
ACCGTCGCCGGCCCACGGACCTGGATATGCAAGGCACGAGATTGAGGGCATTGGCGGGGTCGTCAAGAGGACACGGGTCA
AGATGGTGCGTGTGGGGGCCTGCGTGCACGACTGGGAGGACGAGCTCACCAGGGGGGTCATTTTGGAGAGAGAAAAAACC
GGCAAGGCAAGAAGTTGGTGTGGCTGGTGCTGGCGGCCTATTCCCAGCACCAAGGACGTGCAGACGGAAGGACAGGGATC
ACCGACGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62