GenePrediction:GLEAN_26 Details

Name: GLEAN_26
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:187052..188882 (+ strand)
Length: 1831
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:187052..187237 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_179:187385..188689 (+ strand)
Length: 1305
Type: CDS
Source: GLEAN
Position: GCSC_179:188742..188882 (+ strand)
Length: 141
>GLEAN_26 class=GenePrediction position=GCSC_179:187052..188882 (+ strand)
ATGCCAGCAGCAAGCCAGGCGCCCGTCAAGCGGAAGCGCGCTGTCCAGGGGGAGGCGCCGAGAAAGCGGTCACGGTCAGA
GAGCGGGAGCGGCGATGACGACGACGACGAGCCGAGCGGCCAGGGCCGCATCCTGTTGCTGGAGCAGGCGATTGTCGAGT
CTAAGAAGAACTACAACAACATTGTCGTGCTGCTCGACCTGGCGCGGGGCGCGCCGAACGGGGACGACGAGGACGACGAG
GACGACGAGAACGATGATGAGAATGAAGGACCGGCACTGACGGCGTCGGTGGCGCTGTGTCGCGTGTTTCTGCGGCTGCT
CGCCGGCGGCCAGCTGGCGAACAAGAAGACGGCCGGCGAGAAGGACCGCGTGGTCGTGGGCTGGCTGCGGAGCCGCCTGG
CCGAATACGAGGACGTGCTGCTGGCCATGTTGGGGCGGACGGGCGAACAGGCGGCCACGGCGCTGACGCTGGTCATGCGG
CTGGTCCAGGCTGAGGGAGAGCATCTGCAGGGAGGAGAGAAGCCGGAAGAGGACAAGGACAGCAAAGCCAACAAAGGCAC
AAAGGGCGACAAGCCCCACTACTTTCCCCAGGCACTCTTTCGCCGTCTCGTCGGCTGCCTCGTGCACGCTCGCCAGCAGC
TGGGCGTCGAGGCTGGCGAGGCTCTGGCCGACGAGTTTGTCGACCGCTTTGCCGGCTCCTTTCACGATGTGCGCTTCTAT
ACCTTCCGGGCCGTGACGGCACTCTTGCAGCAGCACCACGGCCACCAACAAAAACAGACTGGCACCGACACGGTCGAGGC
TGCCCTGTATCTGCTCTCGCTGCTGGACGCCGTGCCCGAAGAGCCGCTCGAGGACGGGCCCGAACACTTTTACGTCCGCC
AGCCCAGCAGCCAGCTTCGGTCGTTGGCCCAGCACAAGAAGCAGGCACAGGACGCCTGGATTGCGCTGCTGAGCAGCAGC
ACCACCGCTGCCAGCACCATCATCCGCAAGCGCGCCCTCGCCCTCATGGAACCGGTCATCGCGCCCTGGTTCGTGCGGCC
GGAACTGCTGCTCGACTACCTGACCGACTGCTACAATGCCGGCGGGGCGACATCGCTGCTGGCGCTCTCTGGGCTCTACT
ACCTCATCCGCGAGCGCAACGTCGACTATCCGGCCTTTTACACTAAGCTGTACTCGCTCCTGGACGGCGACATGTTGCAC
TCGAAGCACCGCTCGCGCTTCTTCCGCCTGATGGACACCTTTCTGGCCTCCACCCATCTGCCCGCACAGCTGGTCGCCAG
CTTCGTCAAGCGGCTCGCTCGCCTGTGTCTGCACGCCCCGCCGAGTGCTATCGTCAGCGTCGTGCCCTGGATCTACAACT
CCTTCCGCAAGCATCCGCTGTGCACCTTTATGATTCACCGCGTCCCGGCCGACCAGCACGCCCGCGATCGTCTCGCCCGT
GATGGCCTCGCTGACCCTTTCCGCCCCGACGAGTCCGACCCGATGGAGACTCGGGCTATCGAGAGCTGTCTCTGGGAGAT
TGTTCAGCTGCAGTCACACTACCATCCCAACGTCGCCACCATTGCCAAGATCATTTCCGAGCAGTTCACCAAGCAGACCT
ATAACCTTGAGGACTTTCTCGACCACTCATACCAGAGTGTGAGTTTTTCTTTTCTTTTCTTTTTTCTTCTTCACCCCGCT
GACCCCTCAGCTCTTCGATGCCGAGATCGGAAAGGAAGTCAAGAAAACCCCCGTCGTCGAGTTTCAGATTCCCAAGCGCA
TCTTCTTCCCCCAGGACCCCGCCGCGGGCCTCGAGGACGGCCTTCTCGTCAAGCTCTGGGACTTTTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62