GenePrediction:GLEAN_2700 Details

Name: GLEAN_2700
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2737582..2740035 (+ strand)
Length: 2454
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2737582..2737948 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_140:2738012..2740035 (+ strand)
Length: 2024
>GLEAN_2700 class=GenePrediction position=GCSC_140:2737582..2740035 (+ strand)
ATGAAGTCTGCTGCCTACACTCTCGCCTCTGCCATCCTTGCAGGATGCGTTGCGGCCTCTAGCTGCGATGCCGACAACTG
CTTGCGTGTTTTCCGGGCGACCAACATCACCGGTCGTCTGCAGAGTGCCCAAGAGTTCTGCTCCATGTACACGGCTACAG
GCACCGCGGCAGCTACTGCGGTCATCCCGGATTACGCTGCGACTGCGTGTGCGAGCAACCAGGTCGGCCCCGAGTCTTTC
CGGATCTCGAGTGCCTGCTCGTGCATTGCCACCAGCACAGCGACGCCAACAGCAACCGCATCTCCCACGACTGCGAACCC
TTGTGCTACTGTCAGCAGTCTGTGGTCTGCTGTGGCTGCCGTTAGTCGTAAGTCGAGAGCCGATATGGACGAGGTGTCTT
CCAGAACAGATTGCTAACAGGGACGCGCAGCCACCCCAACAATCCCGGCTGCTCTTGCCTACGAGTGTCTGCGTTCGGTT
CCCCTCCACAAGGACGATGCCATTGAGCTCGTGGAATCTATTGAGCCGTACCTGGAATGGCAGACGGATGCGGCCTACAA
GGCTGACCCGCCGGCTACCTACTTCTACCCGGCATACGACATGTTTGCTACGCTTGCTGAGATCAAGACCATGCTTGAGA
ATGATATGTACACTTCGGAGTACGATTTCCAGGCGGACCTGTATGCCAAGGTCTTTGGCCAAGGCCATGACGGCCACTTT
GTCTTCTACCCGGACCTTCTGACCAGGATCTTCCAATTTGGCCGCCCGTACTCTCTCGTCTCGATCTCCGAGGACGGCAC
ATCTCTGCCGGTCATCAAGGTTTACGAAGACGTTCTTTCGTCGCCAAGCACGGCCTCGACCGTGACACACATCAATGGCA
TCGATGCGGCAAAGTACGTTGAAGACACCATCTTCACCGCATCTTTCAACCAGGATCCCGACGCTGCATACAACAGCATG
TTCTTCTCCAAGGCTTCCTCTGGTGCTTCCGATGGATCGGGCTTCTTTAGTGGTTCTGGTCGTATCCGGTATATCTACCA
GGGCGCCAACACGACCATTACCTTTGCCAATGGGACAGAGCTCGCCTTCGAGAACTTTGCCCAGGTCAAGACGCCGCTCA
ATGGCATCACCGATGGCGAGTCCCTTTACACAAAGTTCTGTGGCGCGGTCGACTCTGGGGACCAGGCAACGTCGGCTTCC
ACTTCTTCCGGAATTGTGGTCCCTGGTTACCCGAATCCTATTGCCATCACGAATGACTCTATCGTGTCGTGCTACTTCCT
CGATGGCGAAGGCTATGAGGATGTCGCTGTTCTATCTCTTCTGGCTTTCGAGTCAGAGTCGCCGTCTGAGTTCCAAGCCG
TGCAACACGAGTGCATCGTCAAGGCTGTGGCAGCAGGCAAGACCAAGCTTGTCGTCGACCTCAGCGCAAATGGTGGCGGC
TACATCCTCCAGGGCTACGATTTCTTCCGCCAACTGTTCCCACACATCGTGCAGGACGGCTTCTCGCGCTGGAAGGAGAA
CGACGGCTTCATGGCCGTGTCGAAGATCTACAGCGACCTTGTGGCTAAAATCGACCCTTCCACTTCCTCTGACAGCGATC
TGATCGAGGACTACGAGTCTTGGTTCAACTACAAATACGACCTCAACGTCACTGACCAGCCGTTCCTCACGTTTGAGGAC
AAATTCGCCCCGCGTGTGTACAAGAACACCAACTACACGGCCGTTATGCGCTGGAATCTGACTGATCCGCTGACGACGTC
CAACTGGACCTACGGCCTGGGCATGGAAATCAGCGGCTACGGCTCGCTGGCCAACCTCACGCAGCCGTTTGAGGCCGAAA
ACATCATCCTGGTCTACGACGGCTACTGCGCATCCACCTGCACGATAGCGTCCGAGATGCTACGGATCCAGGCCGGCGTC
CGGTCTGTCGCCTTTGGCGGCCGTCCTATTGAGGGCCCTATCCAGGGAGTTGGCGGCATCAAGGGATCGCAGACGCTTAG
CTATTCAGACATTCACAGCGAGGTGCAAAGTGCCATATCCAACACAGAGGACGCCGAGCAACTGGCTGCTCTGCAGCGAT
ACACTGAGACTCCGATCAAGCGGTCGTCGGCTGCGGCTCTCAACACGCGCGATCAAATCCTGCGGGACAACCTCGAGGAC
GGCCTTCCCGCCCAATATGTGGTCGAGGAGGCCGACTGTCGGCTGTACTGGACTGAGGAGATGATCACAGACGTGACCGC
CGTCTGGAAGGGTGCAGCCAATGCTGCCTTCAACGGCGGGAAATGCGCGGCCGGCAGCATCCCGCAGTCGAAGAAGAAGA
GGACCAGCCGGATCGAAGGAAAGCGGCACGTCAACCTGGGCAAGGGCTTCGTCGACTTCAACCGCATCGAGCGCAGAACA
GAGCAGAGCCGGGTGAAGTTCGACGCAAGATACAACCAGAAGGTCATTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62