GenePrediction:GLEAN_2702 Details

Name: GLEAN_2702
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2759437..2761623 (+ strand)
Length: 2187
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2759437..2760476 (+ strand)
Length: 1040
Type: CDS
Source: GLEAN
Position: GCSC_140:2760532..2760634 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_140:2760679..2761341 (+ strand)
Length: 663
Type: CDS
Source: GLEAN
Position: GCSC_140:2761471..2761623 (+ strand)
Length: 153
>GLEAN_2702 class=GenePrediction position=GCSC_140:2759437..2761623 (+ strand)
ATGCCCCTCGAACCATCCTCGGCAGACTACTGGCAAGGCGTGCCGGACGACCGTGGCAACGTGCTGATCATCGGCATCGA
CTTTGGCACGACGTATTCAGGTGTCGCTTGGGCCACGCCGTACGACTTTGAGCAGGAGCAGATCAACCTGATCCACAGCT
GGCCCGGCATGGGTCTAGAGAAGGGCAAGGCGCCGACGGAGCTCTGTTATGAGGACGGCCAGGTCTACTGGGGCTACGAG
GTGCCGGCGGACGCGGACGCGGTCCAGTGGTTCAAGCTGCTGCTATTGCGCGAAGACGACCTGAGTCCAGCCCTGGCCAA
CTCGGAGCATGTGCGGCGCTGTCGCCGGATGCTGCACGACCAGGCCAAGACGCCGGTCGACCTGGTGGCGGACTATCTGC
GGCTGCTCTGGGCCCATGTGCTGGACACGATCAGCCGCGACCGGGGCGACGCTGCTGTGGCGGGCATGCGCCTGCACGTC
GTGCTGACGGTGCCGGCGATCTGGCCGGGCTATGCTCGTCAGCGGATGGAGGAGGCGGTCAGTCAAGCGGGCATCCTGGA
CGCCCGACCGGCCGGTCCGACCGAGCTGACGCTCGTCACCGAGCCCGAGGCGGCTGCCCTGGCCACGCTGTACAACAGCG
CGACGGCGTGTCGGCAGGGCGACGTGGTGATCATCTGCGATGCTGGCGGCGGGACGGTGGACCTCGTCTCCTACAAAGTG
ACGCGCCGCTCGCCGCTCGTCATCGAAGAGGCCATCGAGGGCGTCGGCGGGCTCTTTGGCAGCATCTTCGTCGACGAGGC
CTTTGAGCACATGTCGCAGCGCCGGCTCGGCCCCAAGTGGGATAGCCTCAGCAAGGCCGGGGTCAAGGAGCTGGTCCGGG
GCGAATGGCAGCAGGTGATCAAGCCGCAGTACAAGCACATGGCCAACTCCCGGCGCCAATACACCGTCGGGATCCCGGCC
GAGGCGTTTGCGTCCAAGGCCGAGCTGAACGACGTCAGCCGGGAGCCGCACATCAAGATGGGCCGTTTCCATCTGACCGG
GTAGGTCTGTCTCGTTTCTCTCCTCGCTTTTCGAGCGTCTCCCTGACAGTTACAGCGACCAGATCGAAAAGCTGTTCGAG
TACTCCTTTGACGGCATCGACAGGCTCATCGACGAGCAGATCAGCGCGATCAAGGCCACAAAGGACCTATCCGTCTCGGT
ATGTCTAGCTGCCATCGTGAGAGGCCGTTGCTGACAGTCCAGGACATCATCCTCGTGGGCGGTCTGGGCGGCAGTCCGTA
TCTCCACCAGCACCTGAAGGAGCGCCATGGCTCCGACATCAACGTGCTGCAGTCGACGGGAACGAAGCCGTGGACGGCCA
TCTGTCGTGGCGCCGTGTACAAGGGCTGCTACAAGACATTCGTGGCCGGCGGCGAGGGCTACCGGCCGCTGCCGGTCACG
GTCGCGTCGACGGTATCGCGCTTCTCGGTCGGCCTCTGCTTCTCGCAGCTGTACAGCGAGGCCTACCACCGGGAGGAGGA
CCGGTACTACGACGAGAAGGAGGGGGTCTACTTTGCCGGGCGCCAGATGGAGTGGTATCTGCGCAAGGGCAGCTCGGTCC
AGGCGATGACGCCCATCCGCCACGACTTCTATCTGCTCGTCAACGGCCCCAAGACCGAGTGGACGCGCGAGCTGTATCTC
TGCAACAGCGCCGACGCGCCGTCACGCAAGGGCGACGGCGTGGAAAAGATGTGCGACCTCACCTGCAACTTTGCTTCCAT
CGTCGACCGCCTGCCCTACTACGAGTCGCCCAGCGGGCAGATCTTCAAGAAGTTTGCCTACGAGATCGTCATGATTCCGT
CCGGCGCCTCGGTCGAGTTTGCCGTCCTGTACCAGGACCAGCGGCTGGCCAGCAAGGAGGTCAAGGTGTGTTTTGATTAG
GGATCGGCCAAGGTGGTGGACCAGCCCCGCCAAATGGTCCGTGCGCGGATGCCTATTAGTAATGCCCCACGTGTGATGTC
GCCATGAAGCAAACGTTCTCTCCGTCTCTAACAGCAAGCCGACTTTTGGCTCCGCTGCGACAGCCTGATCAGCAATCGGA
CATGCGACAATGCAGTCGCCTACCCAGAAGCCATAGCGACGGAGCTCAGACAGTTCCAGCCCTCACACGGCTCCCAGCTT
TCGCCCCAACACCCCGCACTAAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62