GenePrediction:GLEAN_2704 Details

Name: GLEAN_2704
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2764852..2768670 (+ strand)
Length: 3819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2764852..2765865 (+ strand)
Length: 1014
Type: CDS
Source: GLEAN
Position: GCSC_140:2766056..2766239 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_140:2766289..2766332 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:2766400..2767557 (+ strand)
Length: 1158
Type: CDS
Source: GLEAN
Position: GCSC_140:2767628..2767678 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:2767765..2768244 (+ strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_140:2768302..2768433 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_140:2768656..2768670 (+ strand)
Length: 15
>GLEAN_2704 class=GenePrediction position=GCSC_140:2764852..2768670 (+ strand)
ATGCTCACCCAGCCAACATACGCCGGCCCAAGCGGTGCCAGTTCTGGCTCGAAAATTGATTCGGCCAGCCACCATTCGAT
GTACGGCAACCAATTTGAGGTCGAAAAGCAAGGCTGTCTCTCGTCCCTACCTCATGAAGAAAGAGAAATCAGAGATCACT
TGTCACACTATTTTGGATGCATAGAAATTGGGGAAAGGAAAAACTTCTTTGAGAATGAAGAACTCTGGAAACAATTTGAA
AATCCAGATGAAAAAAAGAAAACCGTGGCTGCCAGTATCCTCACACAGCTCAAACGCATACGAGTCTTACGTCAAGCAGT
TGGTGCCAAGACTGGAGATCAACTGGAAGATGACGACCGTGTCAATCACAAGTCAGCCCCGAGCCTTGTGGACAACATCA
CAAAGAGTCATGAAGCGTGGTTCAACTCTAAAGAATGCAAGTATGGGATCGAAAAAGTTCGCGCTTGGAGACAATCGAAA
CCGAAACGGGAAACTGGTGATAGTCAGACCGCCAACGCGGGCCCCAAGGGAAGCGCAAACAATCACGAACAGGACAAAAA
GGAGTGGCAGGATATTGAGAAAAATATCGGCCTACTGGAAAGGTCGAGCATCGAAAAATACGATTTGGAGAAAGACGTCA
ATTCTTATATCATAAGGTTCAAGAAGAAGGATGGTTACCATGGTCATTCTGGCCTTGAACTGTGCGACTTTGGGCAGTCT
GAGAAGAGCGAACATATCAAGGGTCACTGTCCTGACCAGAGGATTGCACTGAAATACCTGCTCCAGGACAATGAAATCAT
CGGCAGGAATATAATGAAAAAAGACAGCAACGAGAACGGTAGCAACACGAAAAATCAAGAAAGCCAAACGGACAATGCTA
ACACCGAGGGCGGAAGCAAAACCCCCAACTCTCAAGTTTCTGAGAGCACCACGGCTGACGACAAGGAGGAAAACTGCAAA
AGGGCCAATGACAAGAAGGCCAAGGGCAGTAGCAACAGGGACAAGCAGACTGACGTCCGCTACATACATATACCGGCCAA
CAACATGCATGCAAGTTTTCCCTCCCTGGCACATTCCCAGTCCCTGCTATGTTTGCTAGTAAACTCTCTAACGATATTCA
GTGGGTTGAGGTAAGTTCAAGAGTAACAAAAAATATTCTCACCGTTACACTCTATTCGCTTTGGCAGCGCTGACTTAAAC
GCAGAGCCTTATTGCACGGTACTACGGCGAGGAAGGCGACATATTTGGCGAGAAAGGGGAATCATCAAAGGATTCCGAGG
CAAAAATGCTGCTTCGGCCCCAATACTGGCGTGGCCAGCACCACGGGACCGGGAGCAGCGCGGTTCAGGCTCGCCACATG
AGACCCATTTGCGAAACGGTGTCATCTGGTATGTCATTGAAAGTCCGCGGTTCCCACATTTGTTAACCAAGTACAAGATC
CAAAGAGGGCAGAGGAGGTCGCCAAGAACATGGTGTTATTTGTGAGAGAACAAATCCCGAATCCCATGTATCGTGCTTCC
AAAGCGGCCTCGCTGATGGACTGATTAGATGCCATATCTGCATTGGGAGGCCGACAGGAAGCGCGAAGCTGTGGCGCAAA
TGATAGACGAAAAAGTCGGTAAATTTCACAAACACAGAGACAAGGAGAAAGAGGACGAGTTGAAGGCACGATTAGATGAG
CGCAGAGGCCTCGACCGAGAACTTCTTGAACCACGTTTGAACTTCCACCACTTACTCAATGCGGACGAGAAGTACGCCGT
GCCTGAGGTGTATAAGCAAAATGTCCAACGGACTAACTACAACCCTGTGGATCAAATTGAGAACGCAACAATGGGGCTTC
TGGGAAAGCAGAAGCACAACCGGATCCATGTGGACACAAACGGTCGTATAAAGAATAAGCTGGGACAGTTTTTGCTGGAC
GCCGCACGTCTGTCCGAAGCCATAAGCAATCACCGGGACAGGGAGATGATTAACAATTTCCTTTTCCACAAGGCCCCACT
GCATCCACGGAGAACTCTGGACCAGGCTCACTTCTGGACACTGAAATCGACACGAACTAGGGATCGCGACCAGGTCGTCT
ACCGTGGCACCAGCATAGATCTTGAAAAAGCCCACCGGCTGAAGGAGGTCCCCAGAAAAAGGAGCAACTGCTGGACGGCT
TTCAAGAAAATGGCTGTACCCGGAAGAAAAGACGACGGGTCAGAAATGAAATGGACATACACACACGACTCCCGGTGTCC
AAGTCAGAAATCCGACAGAGATTCTAGCATGACTCGCAAGCTGTCATATTCCCTGTCGGCAAATAAGTGCTATGAAGGCG
ACAATAGAGAAGACGTCACTGCGGAAGCCCAAGCGCCTGCACCGAAATGCTTTAGCAGCAATACCAAGGCTGCTGCCAAC
GGCTCAAACCAAAAGAAAGCCGCAGAAGAATTTCGGCGATGTGAGCAATGTCGTGACAACATTCGCAAAGTGTCACGCGT
CGTCATGGTTGACCAGCTGTGGATGTGGATTTTGGATGAGAACACCATCATCACCTGTTTCCCACGACGATATGGCGTGA
ACAAGAGGGACGAAACCGGCGTGCACAAGTCCATCCGGGAACGTTTACAAATGGCTCGCGAGTATCAGTTCCGCTCTGTC
TACGACATTGCCCTCTTGATTCTTGACGAGTGTTCCAATACGTTCTTCGATCGAACCAAAACTAGTGTAGGCTTGGCATT
TCACGCGCGGTCATGGCAGAAGGAAGGCGGCAAGATGACGGCTGACGAACGCATAGGAAATCCTTCCACATGTAATGGAC
ATATTCTCAGAGGCCATAGGCAATGCGGTAAGTGCTTTCCTTTGATGTCAGAGAAATAGCGGGCAAGCGATCTGATACCG
CTACAGGCATACAAACAAACGACTTTGTTCCAGCACTTGTGGCATTGGACAGAGGAGGCCTCTAGAATGTACCGGACGAA
GGCGTACAGTAATGAATTGAATGGCGTATACAAGGGCTTGCTTGACATCAATCCCGAGGGGAAAATCCAGCGCGAGATCA
AGGACATCATAGAGGAGCTTGATATCATGCTACACTTTCACCGCAAGCAGTGCGAGATTGTCAAGCGGTTTCACAAACAC
GTGCGGTATATTTTGGACCCGAAGGGCTTCAAACAGTTTGATGGTTTGTATCTGGCCGATGAGGATCCAGAACCCCAGGC
CGATGAGGATTTACAACCCCAGCAGAGTTTCAGCCGCATCAACAGGTGTTTAAAGCCAAATGAAGAAGAAAAGGACGGAC
TGCGCAAACTGCAATGGTTCCAGACACAATCAATCGAGCTTTTATCTGACATGGGAGATTGGGTCCAGGAGCTGGAGGGC
CTGAAGAATTACGCCCAAAGCACGGCACAGAGCGTATGCATCTTGAGTCAATCACAGGGCAGTGTCTCGCAATGCTAATG
CATTTCACAGGTCAACGACTTGCTAGCTCTCAAGCAGCAGCAGGCCAGCGTTGTCCAAGCCTGGCAGGCGGTGCAGCAGT
CGGAGGAGACTGTTAAACAGGGCAGGGCCATCATGGTGTTTACTATAATCACCATCATTTTTGTAAGCCTCGTTTGGTGC
GGATGTCGCAAATTCTTAGTTCTGCCAGCTAACCCATACAGCTGCCGCTGTCGTTCATGTCCAGTATTTTCGGCATGAAC
AACACTCATGGAACCGATGGATGGACTTTGCGTAAACAGTTTCGACTGATGTGTGAGTTATTTCTCGTGTCCGTTTCCGA
TAGTGTTTGACCACAGCCAATTGGCTCTGACACATCAAACACAGTCTCCATCTCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62