GenePrediction:GLEAN_2705 Details

Name: GLEAN_2705
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2778597..2780700 (+ strand)
Length: 2104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2778597..2778925 (+ strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_140:2778985..2779930 (+ strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_140:2779990..2780700 (+ strand)
Length: 711
>GLEAN_2705 class=GenePrediction position=GCSC_140:2778597..2780700 (+ strand)
ATGTGTGCAGCCAGCGCCCGTCCGCTCCAACCGCTAGGCGACGTCGACGGGAGCGGAAGAAAGAAGAAGGCGAAGAAGCA
GCTTGCAGAGCAGTCAAAGCCGCCGCCAAAGGTATGGATGTCCAATATCATCCCGCTCAACCTGGAGGAGAATCCGGCGA
GTGGTCGTGGCCGCTACTCTTCCATGAGCGTGCTGGAGCCTGTCATGCGGATCGAGCGTACCGGCGACATCGAGTCGGCG
ACTAATCCTCCGAGCGGCGGATCCGAGGCCTCATACCGCATCGTGGTCACTTTCATCTTTGAGGTTGCTATCTCAGGATT
TGACCAGGGGTGAGTATGGCCAGGCTGACTGGTCTGGCAAGCAGTCGAGCTGACGAGGATTTGTCCAGCTTCCAAAAGCA
CAACCGCTTCTTCGACTCTGTTTCCCTGCGGTATCTCTTCCGCCACGGCGAGGAGGTCGATCTGCGGCCGCTGTCCGACT
CTGCCCAACACGGTATCACCGTCACCAACACGCGAGACAAGTTGAACTCCATCGACGCCGGCATGTCTGCTGGCATGGTC
ACTGCCGTGGCACCCACGCTGAGTGTCCAGGCCCAACGCGACTTCAAGCTGACCTACCAACGCAGCATGAACAGCTGGCG
CATGGGTCTCTCCTTCGAATCCTGTGAGCAGTCCAGCCTCGCGAACGGGAGCCAGCGTGCGCTGACTCTGTCCAAAGACC
CTGTTCCAAGGCCGGAACGATCATGTCTGCCGTTGACATCCATTCTGGCTGCTCACCTGGTATCCAGACAGCAAGCACGA
CCGAAGCGAGACCGGAAAATCTACAGCTCTTCTGGGCAGGACCTGCGACAGAAACACTTCTTTCAGGTGCTGTCACCTCA
CAGACAGGACTGCCATTGTCGGCCAAGCCGGCATAGCGGTTGTCCACTTAAATATCGCCACCAGCGCCGCCACCAATATT
ACAACCGTGCCGCCCACTGGTTCTGGCAGACCGAGGCTTCTCTACGCCTGTGGACGCCCGAGATCTACAGCAGCTTCCGC
TGTCCCATTACTGTGATGCGTGAGGTGCCCGTGGCCGTGGCCGACAGAGTGCGCCGCATCGAAGACTTGCGGCCTCTTCT
CCACTTCGACTTTGAGGTCGACACCCGTCTGCGTGTTCTCGGCTGTGGCCTCAACTTCTTCAAGAACGCCGTCAAGCCAG
CCGAGCTCCGTGCTCAGACCGACACGGGACAGCAGCTGCCCGGAGATCACGTCCGCTTCTGCATCACCTGCTGCGCTGAG
AATATCAGCTGGCCGCAGCATCCGACACGAAATCTACAGGCCGAGGCCGAAGAGGTATGGCCGAACGGACGGACCACTTG
TTTTCTTGCTAGATCTCTAACACTCCATAACAGGCTCTCGGACCTGGGCCGAACCCGAGACGGCTGCAGACAAACGAAGA
GTTTAGCGTTTCTCTCAGGCAAAGAGGCGTGAAGCGGACACGCACTGCACACAGCCGTCTGATGGACGATAGCAGTTCCC
GCTCTCCTCTTTTCGAACGCTTCAATTCACCATTCCAGCAGCTGTCTTCCTCCTTCAGTTCTCACCAATCATCGCTGCCT
CACGGGCCATCATTCTCAGGGGACTTCGTGTTAGGGGCCGACAGACTACCGCCGCCTACCGTGGCCGACGTGGAGATTTC
GCCAGCCTGCTCGCGACGATGCTTCGTGCCTGATCGTGGTTTATTGCGGCGTGACGGCGGCGCGGCAAATGCCGGCTCGA
CACAAGCACCGCCGAAGCTTGTCGCGGACGATTGGAGGTGGACGCCAGCAGGTCGGTCACCAGAGAGGATAGATCTGCAC
AACGTTGAGGAAGCCTATCAGCGGTCCGATCACAACCCGAGCAGCGCTGACCGGAGACGACATTATCGCACAAGTGAGGA
CAAAGGCCCTAGGCCGGTGCTCCGAAGACGGACGAGTTTGGAATTGCTGCTTGCGCGAGAGCGGAGAAGGAGCCCAGATG
GTCATAAAGATACAGAATGGAGGCGGGAAGGACATGAGCCCCCAAATTCAGGAAGGCAACAAGTGCGCTTTCAGCCTTCG
GAATATACAGATAGTAGGCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62