GenePrediction:GLEAN_2706 Details

Name: GLEAN_2706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2786038..2788110 (+ strand)
Length: 2073
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2786038..2786183 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_140:2786252..2786522 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_140:2786594..2786810 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_140:2786874..2787182 (+ strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_140:2787245..2788110 (+ strand)
Length: 866
>GLEAN_2706 class=GenePrediction position=GCSC_140:2786038..2788110 (+ strand)
ATGAAAGGACAAGAAGAGGATATGCAGCCCGCAGAGAGTTCAGTCGTGCAGTTCATCGAGGATCGTGGGCCCCAGTTCCA
TCACGTCTTCGCAATGCCATCCTACTTCGACAAGTCGACTTCGACTTTCGAGGCAAAGATTGTCTTGTAAGAGATCGGTC
TGCTTCCGATTTGCGCTCCGTTTGTCTGTTGTAAGCTAATCTTGTCTTGTATAGCGAGCTTCGCGAGACGATCGAGCGGT
GCAAAATACAGACTCCCAACCTGGTTGACTTCAACCTCGATATCAATTACTGCACCTGGGAAGAAGTCAAATTGGAGCTG
CACAAAGCTAAAGCTGCCGCGGCTTACAGTCGGGATCGCGCCAAATCTTTCATTCCCGGCCTTTTTTACGAACTTGGAAA
GGGGCACGACTATTTCGAGGCAGCCCTCGATGCCATTCCAGATTCAGCTCGAGTCCTTCGTGCAGGCCTCGCTGTTATTT
TTTGTGTATGTATCTCTCTCGATAGTGAATGTCCTTGCATGAGGGCGGGAGCTCATAACCGAAAATGTGCGTCTAGTTGG
CTCGACATCGCGTCCAAGTCCGGCAGAAGATTCTAGATGCCTTTGAAAACATCCCAAACATTGTGCAGACGGCTGAGCTC
AAGCTGAGAACTCTGGTCCGCGCGGGGAAAGAAGAGGCAAACAGGGAGCTGAACGAAAAAGTGAAAGAGTTGCAGAAGAC
CCTTCTAGAGACAATTCCACACTTGATCGAAGCGCTGAACCCAGGAACCTTCCGTGAGTACCATTCCCCGATTCCATATC
CTCCCGCTTCTTTCACGGGTTCTTTAAATTAATCAGGACCGGCACCAGTTCGCAGAGCGCTGAGTCCCTTCCGTGGATTT
AATATAGATGAACTGCTCGGGACCGTGTATCGCAAGGCCGACACTGTACACATTTACACGGAGAGAATCAAGGACGAAAT
CATAACTGATACCCACAACTTGACATGGGACACCAGAAAGCTGTCACGCGAAAATCGTGAGAAGATCGATACCCTCCATG
CGAAAATCGACGAAGTTTTGAAGGAGCAGAAAAACTTGCAGAGTCTTTTTGATCTTTCTAGCAGTAGCAAGAACTTTCTG
TTTCAATTTCTGATGGACAATCAAAGTAAGTCAGCAAATGTCCCTCGAATCATGTTTGAGCCCAAGCTTCCGCTGACACG
CCGCCAGAAAGAAATGGAAGCATGAGCGCCGAATCTTCGGCCGATACGCTTGTGAACGAGCCTCGGAGCTTCGTCCCTGC
ATACCCGGGTCCTACCTTCACGCCGAACGAACTGCTGGAACTCTTGGAAGTGCCACACCTCGGGCTAAACGAGGACAAAA
CCCACGTTCTTCGTCATGGACGATCATTAGATAATTCCACACTTAGTGCGGCATCGCTCTTGATCTGCTGTCGGCAGGTC
CAGCACTTGTTTGGTACGCCCACGTCTGGCATCGTCCTGGTCGAGGGCTGCGGGGACCGCAGTCAGTCAGCACGTGTCTC
GCCCATCTCAGTGGTTTGTGCCACTCTCTCGCACACGCTGCAGTCCCGGCCTACCAGCGTTACTCTGCTCTTTTTCTGCG
GACGACATGTAGCCAGCGACGACGAACTGTGTGGCCCTCTAGGTCTTATGCGAAGTCTGCTTTCGCAGCTGATCCTCCTC
ATGGTGCAGAAGAACTGGGTATCAGGTCTCGCCCGGATCGGTCTCTCGTGTGGTGAAGAGGAGTCGGAGTGGAAAGGCCT
CTCTTTGCACGATGTCTGCCAGCTGTTTTATCGGGTGCTGGAATCGATCCCTTTGGCGGCAGAGGTAATCTGCATCATCG
ACGGCATCTCGTTCTTTGAGCGTGATGAATGGTGCCATGACTATGATCTGGTCATGAACACCTTTGGGACAATCATCGAC
GAAGCAAAACTCAACCCCAAGTTCAAGCTGCTCATGACGACACCAACGCGAAGCAGTCGACTGTCCAGTCTAGAGCAGCA
TCAGCGGGTAGCCCTCCGGAACAACGGATCACAAATGTCTATCTGGGCAGCATTCCGGGCAGCAGATCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62