GenePrediction:GLEAN_2707 Details

Name: GLEAN_2707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2794044..2794997 (+ strand)
Length: 954
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2794044..2794313 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:2794370..2794652 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_140:2794714..2794881 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:2794930..2794997 (+ strand)
Length: 68
>GLEAN_2707 class=GenePrediction position=GCSC_140:2794044..2794997 (+ strand)
ATGGCCGAGTCCAGATCCGACTATCTCGCCCAGCTGCCGTCGACATGTTGCATTGGCGGCTCCATACACGAGGGCACGCC
AATCGGCAGCGAGGAGCAGGTGGCCGGCATCACGACTTACGTCGCACGGCCGCCCACCGGTGTCACGGCTAACGGCAACG
TCGTCTTCTTCCTCCCGGATATCTGGGGCCTTGCCAACAACAGCAAGCTGCTCATAGACGGCTTTGCAGCTGCCGGATAT
GTTGCCCTTGGCATGGACTACTTTCGCGGGGTGAGTCTATCCTCGTTCTATTCTCGTAGACAAGTTTCTTGATTCTGACT
GTGCAGGACCCCATTTCCAAGTACCGCAGCTCTCACGACGCGAAGCCGCCTCCGGACTTTGATATGGAAGCCTGGCGCGT
CAAGCACTTCTCGTTTGCCACGGACAATGTGCCCGTGTGGGTCGATGCGGCCAAGACGATCTATGGCACGACCGGTTCGC
GATACGGCTGCGTGGGCTACTGCTTTGGCGCGCCATTTGTGGCCAACCTGCTTGCCGGCGACGCCGTCTCTGCTGGGGCC
GTGGCTCACCCGACGCAGCTGAAGGAGGGACACTTTCGCGCTGTGAAGAGTGTGTTGTTCCTTGTCTAGGTGCCTGTGCT
TTGTCTACTCTTACTCACACACCTGTGCAGAGCCTCTATTTCTCTCGTGCGCCGAGCACGACCGTGCCTTTGGTCCAGAG
CCGCGCCGCAGAGCCATTGACATCCTGCAGGAGACCAAGGTGTCCTACCATCTGCAGCTGTTCTGCAACGTCAACCACGG
CTTTGCTTCGCGCGGAAACCTGACTGATCTCTACGAAAGTAAGCAACAGATGGTTCTTTTGTTGGCAAGCACTACTAACG
GTAAAGAATGGGTCAAGGAGCAAAGCCATCGTGGCATTACTGACTGGTTCAACTTCTGGTTGTCGCAGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62