GenePrediction:GLEAN_2708 Details

Name: GLEAN_2708
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2800435..2802046 (+ strand)
Length: 1612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2800435..2800456 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:2800531..2800551 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:2800730..2801700 (+ strand)
Length: 971
Type: CDS
Source: GLEAN
Position: GCSC_140:2801769..2801942 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_140:2801999..2802046 (+ strand)
Length: 48
>GLEAN_2708 class=GenePrediction position=GCSC_140:2800435..2802046 (+ strand)
ATGGCGACACACTATTATCCCCGTATGTGAACCTTTATGGCTTGTCTGCTTGTCCACTTCCCTTTCTGCCTCATTGCTAA
TGGCAACCATCTTTAGCACCGCCTGGAGCGGCAACGGGTAAGCCTTCTCACTTTCTTTAATGCTGCAAGCGGGACGAAAA
AAAGCGATAAGAGCGTGGGTCTGCACAGACAAAGTGGAAAGATTATCCAGGACTTCGGCGAAGCTTCACATTGAGAAAGA
CCAAAGGAGGTCTTGTCATGCCAACAAAAGCATTTGCCAACTAACTGCCTTGCAGCCTCAACACCACAGACCTACCCATC
GCCACCGCAATCACCACCAGCCAACAGAACAAACTTCTCATATGGCGGCCAGCAGGCACAGCCGCCGGTATCGAAGCCTG
CTAACTTCTCCTACCCTCCTCCTCCACAGCAGGCGACACCCTCACCAGCTCCGAAGGCATCGTACCCGCCTCCTCCACAG
CAGCAACAGCAACCTGCCTTCTCTCTTCCACCTCCCCAATTGCAACAACCAGTGCCGTTGCAGCAGGTGCAAGCCCAGCA
GACAGTCCTTCCCATTCACAGCCGCACGGCTTCGCAAGCCTCGCAGGGTGTGCCTTCCACAGCACAGTTTTCTCCACCGC
CGATGCGCGCCCTTCCAGATGCTGGGTTTCCGCCGGAGAAGAACTCATTTGGGTCCGGCAGTCCGGTTGACCAGGATAAT
CGCAGCCTGGTGGACGCCAGTGGTGCCTTGGGCCAGATTGCTGGCGCACCTGCCCCTGGTGTCTTTGTCGGCGCGACAGC
AGTCAATGACGATGTCGGAACCTTCAACGGCGGCAGCTATCGCATCAGCCACCGTGATTGCAACACCATCCTGACGATCC
AGCTTGCCATTGGATGCCCTCTGTCGGCCAAGCCAGGTGCTATGATTGCCATGTCTCCGTCCGTCACGCTCAAGGGCGCG
TACAAATTCAGCATGAAGAAACTCGTGGCCGGTGCCGAAATGGGCTCATCCACATATACTGGCCCAGGAGAGCTCCTTCT
CGCCCCGCCCATGCTGGGTGATATCACCAGCATCCGCCTGAACGGCAACAACGGCTGGTCTGTCGGCCACGACGGCTTCC
TCGCTTGCACGCAAGGCGTCACGAAGGACTACAAGCGACAGGGCCTCGGCAAGGCCATGTTCAGTGGCGAAGGTCTTTGG
GTGTACAAGATCGGCGGCATTGGTCTACTGTGGATTTCGAGCTTCGGTGCCATCATAAAGAAAGATGTAAGTGCGCAGGA
TTGTGAGCCGATGTGTATCTGCCTCAGGTGTCCGTTTGCTAATAGCCGGAACAGTTAGCTGACGGCGAGAAATATATTGT
TGACAACGGCCACCTTGTGGCATGGAACACGAAATACAACCTTGAGCGTGTGGCTTCGGGTGGCATCATATCAGGCCTGG
CCTCGAACGAGGGATTGATCTGCAAATTTACCGGTCCTGGGACTGTGTACATTCAAACTAGAAATCCGGTAAGGCTCTCC
CATTTTTGTTTTGCCGCCAACGCAGAATACTAACAGACATACAGAGAGCATTCAGCGGCTTTATGTCGGGGCAGAGTGCG
CAAGCTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62