GenePrediction:GLEAN_270 Details

Name: GLEAN_270
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:675776..678110 (+ strand)
Length: 2335
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:675776..675817 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_167:675887..675905 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_167:675992..676001 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_167:676063..676233 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_167:676302..677766 (+ strand)
Length: 1465
Type: CDS
Source: GLEAN
Position: GCSC_167:677853..678110 (+ strand)
Length: 258
>GLEAN_270 class=GenePrediction position=GCSC_167:675776..678110 (+ strand)
ATGTTTTCCTCGTCGGGCCACGGCAAGAAGCCGCCGTCCCAGGTATGTGTCGGTCGTTGAAGATTCCCGCGACTTTTGTC
TCGTCTCTTTCTGACCCGTCGGCGAAAGCAGCAGGAGATGGTGCAGGTCGGTACGTTGCAAAGGAGGCGCCTGTCTCGGC
GAGCCGCAGACCGGGCAGATTGGCGTTTGTTGCTGACCATGCCGGCCCTTTTCTAGACCGAGCAGAGTATGTTCTGCCGT
CCTTTAGCATTCGCTCTGTCTGCGTCGTCTGTGGCTAACAGGGGCAGTTCTGCCTCCCCGTTCTGGCGAGCTCCTCCTCG
CGAGCCGGCCGGAAAGAAAGGCGGAGGGAAGAGCGGCGGCAGCAGCAACAGCAACAGCAACAGCAACAACATGCGCGACC
CAACAAAGGTCGTCGGCGCAGCCTATTCGCACGCGGACCTGCTCAAGTTCGACTCTCTGTGCGCATGATTCGGCCTCTTT
ATTTTCGACTCTTCTCTGGTTTCGTGTTTGCTGACAGATCGCCCAGGAGCCTCTCCGGCAGCCCGTCCCGACCACGATCG
CCCCCGCCATCGACATCGCACAAGACCAAGACGCACGGCAGCGGCAGCAGCAGCTCAGGGTCCAAGGCGCCGCCGTTTCG
CAACTACAAGAGCTTCCTGTCCAACACGGACGAGGACTGGAATGCGGACGAGGAGGAGGACGTGTACGGCTATGACGAGG
ATGACGGCGACGATTTTGGGCTGCCCAGCCTGTCCAACATGAAGCGACGGACCCGGCGGATGGCAGCAGCAGCAGCAGCA
GCGCAGAGTGGCAGCGGGCGGCTACGAAGCAGCGGAGACGGCGATGTGGGCTGGGGGGCTGTCGAGGAGGCCGACGACGG
GTTCGGCTCTCGGCCACCAAACAGCGCGACACAACAGCAGCAGCAGCGGCCACGACGCTACTCCAACAGCGCAGACATTG
CCGTGGAGCGACCGGCACCGTCGTATCCGGTGCCCAAGAAGAGCGAGGGCAAGATCTTGCGGCCGCAGTACAAGGACATC
TTGCGGGACCCGGCCAACGCGCTGCACCTGATCAGCCACGCGGCAGTGCCGGCCGGAGCCAGCGCCAAGGAGGCCGAGGC
AGTCAGCGCGCGCATCTCGCGCATCAACAAGTTCAAAAAGCTGCTGCAGGCATCGACGATTCCGCTGCCGGAGCTGCGGG
CACTCGCCTGGTCGGGCATCCCGCACGAGGTGCGCGCCATGACCTGGCAGCTGCTGCTGAGCTACCTGCCGACGAGCAGC
GAGCGGCGCGTGGCCGCGCTAGAGCGGAAGCGGCGCGAGTATCTGGACGGCGTGCGGCAGGCGTTTGATGGCGTAGGTGG
CAGTGGCAGTGGTGGTGGTGACACGAACAGCGATGGCGACAAAGCCGGTGCCAACCGAGCCGGCACCAACCGAGCCGGCG
CCAACCGAGCGAGCGCCAAGGGCCGCGGCCTCGACGAGGCGGTCTGGCACCAGATCAGCATCGACGTGCCGCGGACGAAC
CCGCACATGGAGCTGTACGGATTCGAGGCGACACAGCGGTCGCTGGAGCGAATCCTGTACGTGTGGGCGGTGCGCCACCC
GGCCAGCGGCTACGTGCAGGGCATCAACGACCTCGTCACGCCCTTCTGGCAAGTCTTTCTGGGCGTCTACATCTCGGATC
CGAACATTGAGAGCGGCATGGACCCCGGACAGCTGCCGCGTGCCGTGCTGGACGCCGTCGAGGCCGACTCGTTCTGGTGC
CTCACCAAGCTGCTCGACGGCATTCAGGACCACTACATTGTGGCCCAGCCGGGGATCCAGCGCCAAGTGGCCGCCCTGCG
TGACCTGACCGCCCGCATCGACTCGCCGCTGGCCCGCCACCTGGAGGACGAGCACGTCGAGTTTATCCAGTTCAGCTTCC
GCTGGATGAACTGCCTGCTGATGCGCGAGATCAGCGTCAAGAACACTATCCGCATGTGGGACACATACATGGTGAGTTTT
TTCTTTTTCTTTTCTTTTTTTCTTTTTTCTTTTGTTTTCTTTCTTCTTTCTTCCCCCGCTCACACTTCACCCGTCAGGCC
GAGGAAAACGGCTTCTCCGAGTTCCACCTCTACGTCTGCGCCGCCTTCCTCGTCAAGTGGTCGGCCAAGCTGTGCGGCAT
GGACTTCCAGGAGATCATGATGTTCCTGCAGTCGCTGCCGACACGCGAATGGACCGAGAAAGACATTGAGCTGCTCCTCA
GCGAGGCCTACATCTGGCAGAGCCTGTTCAAGGGCTCGTCCGCACATCTGCGCAGGCCCGCCAGTCGCGCCCCGTCCACC
AACCTGCAGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62