GenePrediction:GLEAN_2710 Details

Name: GLEAN_2710
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2808922..2810710 (+ strand)
Length: 1789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2808922..2809044 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_140:2809109..2810422 (+ strand)
Length: 1314
Type: CDS
Source: GLEAN
Position: GCSC_140:2810486..2810710 (+ strand)
Length: 225
>GLEAN_2710 class=GenePrediction position=GCSC_140:2808922..2810710 (+ strand)
ATGGCCGAAATTGTGGCCAATGCCGCTCCGGCTCATCATCCGGCCGACGACATGCTCGACCCCGTCAAGCCGGGCGTCGA
GGACAGCGATGCCCAGGCCCTGGCCGACATGGGATACGAACCAGTATGTGATTTCGAGAAAGCGAAACACCTAAATCATC
CAGGAATCAACCGCTAACAGCATCTAGGTCTTCCAACGCCATTTCTCCCAATGGACCCTGTTCAGCTTCGCCCTCAGTGT
CTCTGGCCTCTTCGGCACCGTCATGACCACCTTCTCGTATCCCCTCGAGGCTGGCGGTCCGGCTTCGGCCATCTGGTGTT
GGCTCATCTCCGGCATTGGCGCCCTTTGTCTGACCTTCTCTGTCGCCGAGGTCGCCTCTGCTTACCCCACGTCCGGTGCC
CTTTACTTCACCATCAAGTACCTGGCACCGCCAAGCTCTGTTCCCATCGTCGCTTGGATCGATGGCTGGCTCAACCTGGT
CGGCCAGATCTGCGGCAGCGCCTCGTCTGAGTATGGCTCGGCTCAGATGCTGCTCGCTGCCGTCTCCATCGGCTCCGACT
TCACCTACTTTCCCACCCAGGGTCACATCATCGGCGTCATGGCCGCCCTCTGCATCCTGCACGCCGCCATCAACAGCATG
TCGACCGCCTGGCTCAACCATCTGGCCAAGACCTACGCCATCTTCCATATCGCCGTCCTCGTCGCTGCCTGTGTCGCCCT
GCTCGCCCTGACAAAGGACAAACACTCTGCAAAGTACGCCTTCACCGAGGTCATCCCCGATTCTGGCTGGACTCCCCCTG
GTTTCTCCTTCCTCTTCGGCTTCCTGTCCGTCGCCTGGACCATGACCGATTACGATGCCACCGTCCACATTGCTGAGGAG
GCCAAGGATCCTGCCCGCACCGTCCCTCGTGCCATCGTCCTTGCCCTCACCTTCACCTTCGTTGTCGGCTGGCTCTTTAA
CATCGTCCTGGTCTTCTGCATGGGCGATCCCGCCGAAATCCTTGCCAGCCCCATCGGTCAGCCAGTCGCCCAGATCTTCT
ACAACGTCCTCGGCAAAGGCGCATCTATCTTCTTTGTCGTCTCTGCCTTCCTCATCATGAACTTTGTCTGCATTACCGCC
CTGCAGGCCGGTTCGCGCACTGTCTGGGCCTTCTCCCGTGATCAGATGATCCCCGGCTCTCACATCTGGTACCGCATCTG
GTCCAAGACCGACACTCCCGTGCTTGCTGTCTGGCTGTACGCCATCATCTGCATTCTCATCAACCTGATCGGCCTCGGCA
GCTACATAACCATCGCCGCCATCTTCAATGTGTGCGCCATCGCCCTTGATTGGTCCTACTGTATTCCCATCCTCTGCAAA
CTTCTGTTTGGCAGATTCCAGCCCGGCCCCTTCTACCTCGGCAAGCTTGGTTATGTCCTCAATGCTTGGGCCTGCACCTG
GACTGCCTTCGTCTCGGTCATCTTCCTCTTCCCTACCGTCCGGCCTGTGACTGCCGACAACGTGAGTCTCGCTGCTTTTT
CTCTTTTGGCTTTTCTTGCCTTTGCTAACCTACTCTCTCCTCAGATGAACTACGCCGTCGTCATTCTGGCCTTCGTCTTC
ATGGTCGCTACCGGCTACTGGTTCATCCACGGTCGCTTCTACTACACCGGCCCCCGGGCCAACGCCACTGTCGACAATGG
CATCATTGTACCCGTCGAGAACGTCCACGAGAATATCGGCGATCCCGAGAAGGCAGCGGCTGCTGCTGGTCTGCACCGCC
GGAACGTGGGTGGGGATGAGAAAAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62