GenePrediction:GLEAN_2714 Details

Name: GLEAN_2714
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2828056..2828772 (+ strand)
Length: 717
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2828056..2828577 (+ strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_140:2828631..2828676 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:2828732..2828772 (+ strand)
Length: 41
>GLEAN_2714 class=GenePrediction position=GCSC_140:2828056..2828772 (+ strand)
ATGCGGATTCCCTACGTGCCCAACCCGCCCGAGCCGACGACGGCCGAGGACGCGGCCATTGTGGCCCGCATTGCTGCCCG
CCGGGCGCCGCGGCCGCTGCAACCGCTGGACCTGGCGCTGCTGCACGCGCCCGCCGTCGCCGATGGCTGGAACGCCTTTC
TGGGGGCGGTGCGCACGAAGACGACGGCTCTGGCAGCTGACCTGCGCGAGCTCGCCGTAAGTCGCGTCGCCGTCGTCAAC
CATGCCTGGTACGAATGGGGCCACCACGCCCCGCTGGCCGCTCAGGCCGGCGTCTCGGCCGCCGGCCTCGACGTGGCCAA
GCTCGATGGCCCCCTCTCGCTCGACCGCCACGATGAGCTGCTTGCAACGCCCGCCGGCCAGCCCGCTCCCCTCTCCGAGA
CCCAGTGGGCCGTGCTCGTCTACACGGACGAGATGACCCGCAGCGTCACCGTCGCCGACGCTACCTTTGCCCGGCTGCGC
GAGCTCTTCGACGAACGCCAGATCGTCGAACTCACCGCCGTAGTACGTCTCCGCCTCTCCTCCCATGTCCTGCTCCATTC
GTCTGACTGTGCTAGATCGCCTGCTACAACTGCGTGAGCCGGTTCTTGGTCGCTCTGGATGGTACGTCACAGTATACGCA
TAGTCCCCCTCCCTTGCACCCAAACTGACAGATTAGTTGGCGAGAGGAACGGCACCGGTCCGGACGCAACACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62