GenePrediction:GLEAN_2716 Details

Name: GLEAN_2716
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2834363..2835621 (+ strand)
Length: 1259
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2834363..2834373 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:2834440..2834473 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:2834529..2834646 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_140:2834726..2835000 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_140:2835207..2835232 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:2835441..2835621 (+ strand)
Length: 181
>GLEAN_2716 class=GenePrediction position=GCSC_140:2834363..2835621 (+ strand)
ATGGCGATCCAGTAAGGAGATCGGAGCCCCTTGCTCGCAGCCCCGACGTGCCGTTTCCTCTGACCTCTGCTCAACAGCTA
TCTCATCCTCCTCTCCCGGCAAGGCAAAGTCGTGAGTCCTGCCACGCATCCTCTGCCGGCCTGTCCGCGTTTCTGACCCT
CTCCAGCGGCTGGCCAAGTGGTTCAGCACCCTCTCTCCCCGCGAAAAGGCCAAGATCGTCAAGGATGTCACCCAGCTCGT
CCTCGCTCGCCGCACGCGCATGTGCAACTTTCTCGAGTACAAGGGTACGCGGCCCGAACAAGACCGGCTTGGCCTGTGGC
TCTGCACGCGCATCTTGCTGACGGCCTCGGCCACCGCGAACAGACACCAAGATCGTCTACCGTCGCTACGCATCCCTCTT
CTTCATCACCGGCTGCTCCTCCGACGACAACGAGCTGATCACGCTCGAGATCATCCACCGCTACGTCGAGCAGATGGATA
AGTACTACGGCAACGTCTGCGAATTGGACATCATCTTCTCCTTCACCAAGGCCTACTACATCCTCGACGAATTGCTCTTG
GCCGGCGAGCTGCAGGAGAGCAGCAAGAAGAACGTGCTGCGCTGCATCGGCCAGCAAGACTCCCTCGAGGACATGGAGGT
ATGACCCAGCCCGCGCTTGCTTTCCGTCTGCTTGTCTGCTTGTCTGCTTCCGTTCCCTCGCAACCCGCCCCCGGCTGCCT
TGCCTTGCTGTTCTCCACCGCGCCTGTGATAGGCCGCCCACCTTGCTCCTCTCACAAACGCCTCCGCAACTCCCCCAAAG
CCCTCCATTCTCCTCGCTGACCCTTCCACCTCTGTCTTGTTCAGGTTGAGGACGAAGTCACAAAAATAATGTAGAATCTC
CAGACGTGACGGTGTTTACCGGTGGTGTCTGAAGACCCCCGTGGCTCCCGCTGTCTCAGCCATGGATCATGCTGTCTTAT
TTTGCCGTCTTTGTCCTGTCTCCGCCTGTCTGCCCGTGCAGACCTGTCACAGTCTATATTTTCGATCTACCGTACGCCTG
GATGTTGCTAACGACGGCCCTGTTCTTGGTGTCGACAGGATGCGGAACGAATCAGGGGTGCTCTTCAGGAAAACGGCCTT
TACTGAGCGTGGCCGTCGAGCCAAGACGGACAATCCAGGGCGAACAAGCAAAAGCGAGATGGGCAAAGACAAGACATGGC
CAGGATACAACGGCAAGGAAATAGCGGCAAGCAGCGATGCTACAATTGCGCCGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62