GenePrediction:GLEAN_2718 Details

Name: GLEAN_2718
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2838791..2841897 (+ strand)
Length: 3107
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2838791..2839246 (+ strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_140:2839324..2839856 (+ strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_140:2839986..2841255 (+ strand)
Length: 1270
Type: CDS
Source: GLEAN
Position: GCSC_140:2841409..2841897 (+ strand)
Length: 489
>GLEAN_2718 class=GenePrediction position=GCSC_140:2838791..2841897 (+ strand)
ATGTCATTTGCAGCTGCGGCCACTGGCAGCAATGCTGCAGCAGCAGCTGCTGGCGATGTGGTCGTGCCGGCGCAGCTGGG
CTTTTTTGCCATCTACAACCCGAGTCTGGGCATGACGGACGAGACGATTGACGACCAGATCGTGTACTACGCCTCGGGGC
CGTCGTCATCTTCGTTCTTCGCGCGGCGGAACAGCAGCGCCAGCACGAGCCAATATCGTCACCACCAGACGCCATCATCG
ACCTCACCGCCCCTGGGGTCATCCCCGTCGTCGTGCGGCCTGCCATCAGCCTCGCACGCGGACGAGCGCAACGAGCGGCT
GCGGCAGATCGGCCTGGCCCAGGGTATGGTCGCCTTTGGCAAGAGCTTCTCGGGCGACCAGCCAGTCGACACGGTCGAGA
CGGACAAGACGCGCGTCGTACTGCACGAGCTGGAGCCGGGGTGGTGGCTTCTGGTGGTGAGGACGGACCATTTGTTACTG
CTTGCTGCCTTCTGCCTTCTGTTGCTGACTGCTGACTGCTGACTGTCCCTCAGTCGATCAACCTGACGAAGCTTCCGGCC
CTTCCCGGAAACACAAACAACACAAACACGACCGAGTACTCCTGTCGGGAGGTCAAGCCGGCCACGCTGGTGCTGCAGGA
TCTGCTGCGCGCCCATGCCGTCTTTCTGCTGCACCACGACGCGTCGCTGTCGGCGCTGTATGCGCGCACGGCCTCGCCAG
CCGCAGCGGCACCGTCGCGCTCGCGCTTCACTGCCCTGCTGGCCCGCTACTGGGATGTCTTCCTGTCGTCCTGGTCGGTG
CTGCTGCACGGGAACCCCGTGCGCGACGTGCTGCCGGGCGTGCGTATGGCCGCATGCGGTGAGCTCGGCGTCGGTGTTGG
TGAAGAAGACCGCGGCAGCGGCGAGCGCGAGGTGCTCGAGGGTCTGGTCGAGCAGACGGACGGACTCGTCGACCTGGTCG
TGTGCCGGTTCGGACGCGCCGCCGACGACAATGAGGCCGATGAGCTGCACCAGGACAGCAGAGACAGCAGAGACAGCAGA
GACAGCCAGGCCGACAGCCAGGACATGTTTGGACGCGGCCGTCCGCGAAGATCCGCTTTGTTCGACGACTACCATGATGC
CAGCAGAAGCAGAAGCAGAAGCAGCATCAGCATCGGTGGCGGCAGCAGCGCCGACGACAGCTACTACGACGACAGACGGA
CCAACAGCAACGCGTGGCTAGGCAGCGGACGCGGCATCGGCGCCGAGGACGGGGCCATCTTTCTGGGCGTCGGTGCCCTC
TCACGGCCGTCTCTCCGCACGGTCAGCTACTGGATGGAGGACATCTACAGCTGGGGGAAGCACGCGTACGGCGTGGCCGA
AGACCCGTCGGTGCTGCCGCGCCACGCAAAACGGCGCAAGAGACGAAGCGGGACGATGACAAGCATATCCGAGCAGCAAC
AACAAGAGGAGCAGCAGCAGCAGAAGCAGAGACAGAAACAGCGCGCACGACTCGCAGACCTTCCTCCTCTCTTACCACCA
CCGCCAGTGACGCTTCTCGCACGGCGAGCCAAGTCTGTTTCGTCTCCGATTGCCACGTCCAGCGTGTCTCAGTCCAAAAG
GGACGCTACAGAAGAGGCGGCTCTGTCGGTGTCGCCCGCCAGCTTTGGCCCCATGGACAAGTACAGGTCCTTTATGAAGT
TCGGCTACGGCACATACTGGAGTCTGGGCGCAGGAGGAGGAGGAGGCGGTGGTGGTGGCAGCAAGAACGACGACTCCGTG
GACCCTCTGACTGTCTGTCCCGCAGAGACGAGCACAGATGCGATTTCGAGGGCAAGCAGCGTCACACGCAAACGTCACGT
GCCACGCACTACTGTGGGGCAATACCTGATTGGACTGACCAGCGAAGGAAGCACAACCGAGGCAAAGAACGGCGGCGACG
ACGGCCAGCAGCGGTCCAAGACGGGACCGCGAACGGTCGTGGTGGATCTGATTGAGAGGAGAGTCGGCCGGCCGTCGTCG
CAGGACACGCTGCGCTACTTTAGCGAGCCGCAAGGCCTAGACGACGACGACGCAGACGACGACGAGACAGCAACAGCAAC
AGCAGCAACAGCGACACCGACGCCTGCAGCAGACAACCCGGCCGTCCGTTCAGGGAGGCTGCGGGTTGTCGTCTTTGCCA
AGCAGCCCTTCCTGTATGCCTTCTTCTTCCAGGCAGCCGACGGCGAGGGCGCAACCAAGGACGAGGAGACCGTCCAGACG
CTGCTCAGCCGCCAGGTGACGGTACTGCACAAGCCGCTGCTCGCGTCGACGTCGTATCGGCCCAGCCGGCCGAGCCTGGC
CGGCGTCTCGGCACCGTCGCCGTCAGCATCGCTGCTCTCTGTGGCCGTGGCGGCCGCGCCTGCCAACACCATCTACGACC
TCGTCTGGGATCCGCGCGCGCTGACGATCCACTCGACCATTCCCAACATCCCTGATCCCGGCACGGTCAGCATGCAGAGC
GCCAAGCGACGCGGCAGCAGTATTATCGGCATCGCGTCGCCCTTGTCGGCGCTGTCTTCGCCCTCGCCCTCGCCCTCGCC
CTCGCCGTCACCTGCATCGTCGTGGTCCCGCGTCGAGGCCCTCAACACGCACATGCAGCTGCTCAGCACGTATGCCACCA
CGCGGGCCAACGCGGCCGAGCTGGAGCGTACCTGCAAGACCAGCCGCGGCTGGTGGGTGGTCTGGAACCGCGTCGTCGAA
CGCTCCTCGTCGTCGGCTGCCGGCAGCACTGGCAGCACCGGCAGCGTGTCCGATCCGCTGCTCGAAGAGGACGAAGACGA
CGGCAGCGACCGCAGCGGCTTCAAAACGGGCTCCGACGCCTCCCGGCCGACCACTGCCACCGTGGCCACCGGCTACGCCG
TCAGCAAGGAAATCTTCTTGCTCAGACGCGCCGGCGATCATGTCGAGAGCAGGCTGGCCGCTTCAGCCATGCGGGCCATC
AGCGGCTCGTATCTCGGTCGTGGAGGAACCGCTGCCGATGGCGCCGCCGGTGGCACCGGTTGGACCGATGGCGCAAGCCG
GCTGACACAGGGCATGGGCGTAGACACAAAGAGGTACATCGAAGGGCTGCTGAGCCTGAATCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62