GenePrediction:GLEAN_271 Details

Name: GLEAN_271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:682371..684487 (+ strand)
Length: 2117
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:682371..682467 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_167:682523..682739 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_167:682803..682865 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_167:682933..683781 (+ strand)
Length: 849
Type: CDS
Source: GLEAN
Position: GCSC_167:683884..684487 (+ strand)
Length: 604
>GLEAN_271 class=GenePrediction position=GCSC_167:682371..684487 (+ strand)
ATGGAGCCTTCAAGTTCTGACACGGGCTTTTTCCAGGAGCTGCCAGAGCTGCGAAACCAGTTCTTCGATGACGTCAGCTT
TCAGAGGGTTCTGAAGTGTGAGAAGACATATTCCCCTTGATTTTCCCTTCACACATCTACTGATCCAGCCAGTGCTCGTG
CCGGCAGATCTGCGACAGCAGGTAGAACCAGAGCTGGCTCAACTCGGCGCTGACGTTCTTGAGCCACGCATCTTCGACTA
CATCACCGATGCCGAACGAAACCTGCCGTACCTTCGTGGCGGAGGCCATAATGCGTTTGGCCGACCCATGAGCGAACTGG
TCACGGGTGAGGGCTGGCGAAGCCTGCAGGCATTTGGCATAGAGAAAGGGTGAGCAATCTTGTGTCGTCAGTTCTGGTCT
TCTTCCTTTCCTCTGACTGCTCGCACAAACAGGATCGTTGCGTACAATTACACCACCGACTATGGTGCCCACTCTCGGCT
GCTGCAGATGATGCGGTGAGTTCAACTAACTCCCTGAATTCTAACAGCTCTTCCCGTTTCCGCTGACAGTACAATCATGC
AGCTTTCATCTCTGGGAGGCATCAGCTGCCAGCACCACGTGTCCCGGAGCCATGACCGACGGTGCTGCCCGCCTGCTCCA
GCGCCATTTGACGGCTAAGCCGGACCGGCTGGAGCCTGTCGAGAGGCGTGTCTTCCAAGCCGCCTTCGAGCGCCTCACCT
CGCTCAACCCGGCTGGCGCCTGGACCAGTGGCCAGTGGATGACGGAGCGGCCTGGCGGCTCTGACGTGTCGCAGACCGAA
ACGGTGGCAACGTATGTGGGCGCAACAGCCGGCGGAGATGACGATGTGGATGCCAACGGGGACCCGCTGGGCCCCTGGGC
CATTGACGGCTTCAAGTGGTTCTCGTCTGCGACCGACGCCGGCATGGCCATCCTGCTGGCCCGCACACACTCGTCCAAGG
GCCTGTCGGCCTTCTTCGCGCCCATGCGGCGCCGACGAAGAGCCTCCTCACCGGCCACAGCCATGGCTGGCCCCAACAAC
ACGGAACTCAACGGTGTGCGCATACAGAGGCTCAAGGACAAGTTTGGCACACGGCCGGTACCGACAGCTGAGTTGGAGCT
GCGCGGCACGCGCGCTTGGCTGATCGGTCGCGAGGGTGACGGCATCCGCGAGATCGCAACTATGCTGGCTATCACACGCG
TCCACTGCTCTGTTGCATGTCTGGGTCTGGCTGGCCGTGCCTTGGGTGTCGCCAAGGCCTATGCCCTGGTGCGTCATGTT
AGCGGTGGTCCTGGCGGCCGCTCGCGCATGCCGTTGTATAAGAGCCCGCTGCACATGCGAACGCTGGCCGATCTCACGGG
CGAGTATCATGGCATGATGCTGCTGACAATGTACACAGCGTACATTATGGGGTTGGAAGAGAGGCTCGGACGCACTAGAA
GATCTGATCAGCTGCCCGTTCCCTCCCTCCAACCCCCTTCCCATCTCGTTGCCCCTCTGTTGCGTGCCCTTAGCTCCCTG
CACAAGGCATACTGCTGCAAGCAAGCCGTCCCACTGCTTCATGGCGCCTGCATGGAGGCACTGGGTGGTGTCGGTTACCT
GCTCAACCACGAGACTGAACCGCTCAACCTTGCCCGCCTCTTCCGCGATGGCTGCGTCAACGCCATCTGGGAGGGTACCA
CTGACGTTCTTAGCACCGATCTTCTGCGCACTTTGACCAGTTCAGCCGTTGGGCCTGCCAGCTTGAATGCGCTGGACTGG
CTGGTCACGATCACTGTGTCCTCCGACTCCAACGCCGTCAGACAAAGCTGGACGGACCTGCGCCTCCGCATCGAAGCTGC
CAGCCGCGACGGAGCCGCTCGTGAGAGTCTCCTCGCCGATGCACGCAACGTCCTCTTTTCCGCTGCCGATATCCTCATCG
CCGGACTGTTGCTGGTCGATGCCCGCAGTGATAGCGCACCGGAGGCTGCAGCTATGTCCCGCCGGTTCCTCGCAAAGAAG
GGCTTTGTAGAGCAACGTGCCAATTTGACCGCTCAGGAAGGCTTTGCCACAGACGTTACTGTCGTCTATGGGCAAACGGG
CCCGGAAGCACGACTGGATGCCTCGGCCAAACTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62