GenePrediction:GLEAN_2720 Details

Name: GLEAN_2720
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2852715..2853324 (+ strand)
Length: 610
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2852715..2852797 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_140:2852889..2853324 (+ strand)
Length: 436
>GLEAN_2720 class=GenePrediction position=GCSC_140:2852715..2853324 (+ strand)
ATGCGACGGGCAGTCACCTTCCCTGTCCTGTCGAAGGCCTCCTGGCCTGAGGCTATGGCAGGGCCCTCCGACTCAGCGGT
CAGGTACGAACGGAGCTGAAGCAGGAAAGACTGGCTGGCTGGCTGCATCCACGAGCTTGGGCATAGAGCTGAACAATATA
CGCTAACAAAGCAGCTGCAGCCAAACACAGAACGGGCTCACTGGCTGCCGCGACCAATCAACTGCGCCGTTCGTCATCAA
CGCCGCTGCTCTCGCAGCAGCACTCGCTGCGGCACCGCCTGTCTTGGGCTGCTCATACTCGCAGAGCAAATGGCTTCTCG
AGTCCGAGCGCCACGAACGCATAGCCGTGGGGGGTCTAAACCAAAGTGCCATCATCCAAAGTCTGGACGAGATGCTGCAC
AATACCAGCCAGTGGCACTTCGAGACAATCGCCAATTACGTTCCCTTTTGTCCCCGTCACTCCGAAACGGGCGTTTTTGA
CACATTTGAGGGCTTTCGCAAGAAGGCTGTCACTTGGCCGCGGTTCGAGAACGAACGGGCGGTGGAAGAGCTGGTGCGGC
GTCAGCTCGAAGCTCACCGTCGTGATAAGCATGGGGTCATTTCGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62