GenePrediction:GLEAN_2721 Details

Name: GLEAN_2721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2854203..2857128 (+ strand)
Length: 2926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2854203..2854261 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:2854351..2854378 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_140:2854492..2854547 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_140:2854644..2854893 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_140:2854981..2856472 (+ strand)
Length: 1492
Type: CDS
Source: GLEAN
Position: GCSC_140:2856527..2857128 (+ strand)
Length: 602
>GLEAN_2721 class=GenePrediction position=GCSC_140:2854203..2857128 (+ strand)
ATGGCTGACAACCACGATGCTGCTGTTGCGCCGCCCAAGAAGCACAAGGTCAACTTGGCGTAAGTTCTGCCGCTTTCCTC
TGCTGGGCCGTCTTTTCGACAGCTTCGTTCGTTAAACGGCATAAGCTAATGGCTTATTTTCGACACAGTGATGCTTCCGG
CACCGAACACCGCGATGTATGTTCTTCCCCGCAGTTGAATTTTGTCCCACGAATACTGGGTCCAATCGCAAGAGAGCCAG
GTGCACGGCACTTGGGCGTCGAGACCAGCAAGTACTGACCAAACCGTAGGAGGACGACACTGCAACGGCCATTCTCAAGA
AGAAGAAGAAGCCCAACCAGTTGCTGTATGTCACCCTTCATCTCGCTCTGCTCTTTTTCCATTGTGCTCAATTCTGTGGT
GTTCGGTCGGTGAAATGGCACTGACAGCAGTCTCAACTCAGCGTCACTGATTCCGTGAACGATGATAACTCCATCATCAT
GCTGTCGCCCACCACCATGCACACCCTTCAGCTTTTCCGTGGAGATGCCGTCCTAGTTCGCGGAAAGAAGCGGAAGGACA
CCGTGCTCATCGTTCTGTCTGACGACGACCTCGATGAGGGCAGTGCCCGCCTCACCCGTGTTGCTCGTCACAATCTCCGC
GTCAAGCACGGCGATGTTGTGACCATCCACCCTTGCCCAGACATCAAATATGTACGTTGGCACCCTCTTGTTACTTTTTG
GAATTGAGTTTACGCTCGGATGGTGGGGGTTTTAGGCTGACCGCATTCTCTCGTATAGGCGAAGCGCATCGCGGTTCTGC
CTATCGCTGACACCGTGGAGGGCCTCACTGGTTCGCTGTTCGATGTCTTCCTCGCCCCTTACTTCCGCGAGGCCTACAGA
CCCGTTCGCCAAGGCGACCTCTTCATGGTAAGAGGTGGCATGCGGCAAGTCGAGTTCAAGGTTGTTGAGGTGGATCCCCC
AGAGTACGGAATAGTCGCCCAGGACACTGTCATTCACTGTGAGGGCGACCCGATTCAGCGGGACGAGGAGGAGAACAACC
TGAATGAGGTCGGCTACGATGACATTGGCGGTGTTCGCAAGCAGATGGCCCAGATCCGCGAAATGGTCGAGCTTCCGCTG
CGGCATCCCCAGCTGTTCAAGTCTATCGGCATCAAGCCCCCTCGTGGTGTCTTGCTGTTCGGTCCTCCCGGTACCGGTAA
AACTCTGATGGCTCGTGCTGTTGCCAACGAGACCGGCGCCTTCTTCTTCCTCATCAACGGTCCCGAGATCATGTCCAAGA
TGGCGGGTGAGTCCGAATCGAACTTGCGGAAAGCCTTTGAAGAGGCCGAGAAGAACTCTCCTGCCATTATCTTCATCGAC
GAAATCGATTCGATTGCACCCAAGCGCGACAAGACCAACGGCGAGGTCGAGCGCCGTGTCGTGTCGCAGCTGCTGACCCT
CATGGACGGCATGAAGGCCCGTTCCAACGTCGTGGTCATGGCCGCTACCAACCGGCCCAACTCCATCGACCCCGCTCTGC
GTCGTTTCGGCCGCTTTGATCGCGAGGTGGATATCGGTATTCCGGACCCGACTGGTCGCCTCGAGATTCTTCAGATCCAC
ACGAAGAACATGAAGCTCGGCGACGACGTCGACCTAGAGCAGATCGCATCGGAGACCCATGGTTACGTCGGTTCCGATTT
GGCTGCCCTCTGCTCTGAGGCCGCGATGCAGCAGATTCGCGAGAAGATGGATCTCATTGACCTTGACGAGGACACCATCG
ATGCCGAGGTGCTCGACTCTCTCGGCGTCACCATGGACAACTTCCGCTTTGCCCTGGGTGTTTCCAACCCGTCTGCACTG
CGCGAGGTTGCCGTCGTCGAGGTGCCCAACGTGCGCTGGGACGACATTGGTGGTCTCGATACAGTCAAGCAGGAGCTCAA
AGAGAGCGTCCAGTACCCAGTCGACCACCCGGAGAAGTTCCTCAAGTTCGGCATGTCCCCATCCCGTGGTGTGCTTTTCT
ACGGACCACCCGGTACCGGTAAGACACTGTTGGCCAAGGCCGTCGCCAACGAGTGTGCTGCCAACTTCATTTCCGTCAAG
GGTCCTGAGCTTCTCAGTATGTGGTTCGGCGAGTCTGAGAGCAACATCCGTGACATCTTCGACAAGGCCCGTGCCGCTGC
TCCCTGTGTCGTGTTCCTGGACGAGCTGGATTCCATTGCCAAGGCCCGTGGCGGATCTGTCGGCGATGCTGGCGGTGCAT
CCGACCGTGTTGTCAACCAGCTTCTGACAGGTATGCTCCGTTATTCTGATCGTTGTGTTCTTCACATTTACTGACTATGA
ACAGAGATGGATGGTATGACGTCCAAGAAGAACGTGTTCGTCATCGGTGCTACGAACCGACCGGAGCAGCTAGACCCTGC
TCTGTGCCGTCCGGGACGTCTCGACTCGCTCATCTATGTGCCCCTCCCAGATGAGGCTGGCCGTCTGAGCATCCTGAAGG
CTCAGCTGCGGAAGACACCGACTTCTCCGGATGTGGATCTCGCATACATTGCGTCCAAGACGCAGGGCTTCACTGGCGCC
GATCTGGGCTTCATCACCCAGAGGGCCGTCAAGCTGGCTATCAAGGAGGCGATCACCGCCGATATTGAGCGGACAAGGGC
TGCCGAGGCTGCTGGCGAGGACGTCGAGATGGACGACGAGGCGGAGGACCCAGTGCCGGAGCTGACTAAGCGTCACTTTG
AAGAGGCCATGCAGATGGCCCGGCGGTCCGTTACTGACGTCGAAGTGCGTCGGTACGAGGCCTTCTCTCAGCAGATGAAG
AACACAGGCCCGGGCTCCTACTTCAAGTTCCCCGAAGGTGGTGTTGATTCGGGTCCGAGCAACGCCGGAGGTGCTGTTCC
GGAGGGATTTGGTGATGCAGGCCAGGATGACGATCTCTATGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62