GenePrediction:GLEAN_2722 Details

Name: GLEAN_2722
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2866669..2867614 (+ strand)
Length: 946
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2866669..2866691 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:2866843..2867614 (+ strand)
Length: 772
>GLEAN_2722 class=GenePrediction position=GCSC_140:2866669..2867614 (+ strand)
ATGGCTGCCCCGGGTGTTCAGATGTAAGTTTCATACTACCTGGATATGCATTGGAGGGGCAACGAGGCGTCGTGGCTGGC
GAAGAAGAGACAATGCAAGGATGCGGATGATGGGCGGACGGGGAGTCTCGCAACAAGAAGGGCACACGCTGACTCGATTC
CGTTTCGTCTGCAGTTCCAAGCGGAGAAAGTTCGTTGCCGACGGTGTGTTCTATGCCGAGCTGAACGAGTTCTTCCAGCG
CGAGCTGGCTGAGGAGGGCTACTCCGGCGTCGAAGTCCGCGTCACGCCCACCGTTACCGACATCATCATCCGGGCCACGC
ACACGCAGGAGGTTCTGGGCGAGCAGGGTCGCCGCATCCGCGAGCTCACGTCGCTGATCCAAAAGCGCTTCAAGTTCCCC
GAGAACAGCGTGTCCCTGTACGCCGCCAAGGTCCAGAACCGCGGTCTGTCGGCCGTGGCCCAGTGCGAGTCGCTGCGGTA
CAAGCTGCTGAACGGCCTGGCCGTCCGCCGTGCCTGCTACGGTGTCCTGCGCTTCATCATGGAGAGCGGCGCCAAGGGCT
GCGAAGTTGTCGTGTCCGGCAAGCTCCGTGCCGCCCGTGCCAAGTCCATGAAGTTCACCGACGGCTTCATGATCCACTCC
GGCCAGCCGGCCAAGGACTTTATCGACAGTGCCACCCGTCACGTGCTGCTGCGCCAGGGTGTTCTGGGCATCAAGGTCAA
GATCATGCGCGGCTCCGACCCTGATGGCAAGGCCGGCCCGCAGAAGACCCTGCCGGATGCCGTCACCATCATCGAGCCCA
AGGAGGAGCAGCCGGTGACCCAGCCGATCAGCCAGGACTACGGCGCCAAGGCCGCACAGCAGGCCGCTGCCGCCGAGGCC
CAGCGCGCCCTCGAGGCCCAGCAGGCCGCAGCCGCAGAGGAGGAGGCCGCGCCCGCTGAGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62