GenePrediction:GLEAN_2724 Details

Name: GLEAN_2724
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2876005..2877982 (+ strand)
Length: 1978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2876005..2876055 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:2876244..2876687 (+ strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_140:2876755..2876945 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_140:2877018..2877831 (+ strand)
Length: 814
Type: CDS
Source: GLEAN
Position: GCSC_140:2877893..2877982 (+ strand)
Length: 90
>GLEAN_2724 class=GenePrediction position=GCSC_140:2876005..2877982 (+ strand)
ATGAGGTGGGAAAAGCTCCCTATGAGGGGCGGCGGTATGGGTGCATCTCTTGTTCACAGCCTGATACAGTTTACTTTCCA
TCAACCTCCGGCCTATTCGGGACTTGTCCAAACGACCAGATTTATTTGAGACAGGAACAATGGTTCGTATCCATAGTTGC
TCGCTGCTACTCTCACGAGGCGTGGACCTCGCCACACGCAATTTATCGCTAACATTTTCCGTCTTGTCCCCTTCCTCAGG
TTGTCCTCGCTGCTTCCATTTGCACCCGCGGCGGCAAAGCCGTCCTCTCCCGACTGTTTCGGGACATGCCACGGTCCAGG
ATCGAAGGCCTCTTGGCGTCTTTTCCCAAGCTGGCCGACAGCGGCACGCAGCACACCACTGTCGAGCAGGACAACGTTCG
CTTTGTTTACCAGCCATTGGACGAGCTGTACATGGTTTTGATCACCAACCTGCAGTCCAACATCCTTCAGGATATCGATT
CGTTACACCTCTTCGCACAGGTGGTATCGAGCGTGTGCAAGAGCCTCGACGAGCGCGAGATCCTACGCAATGCCTACGAG
CTTCTGAGCGCCTTTGACGAGCTGGTGACCCTCGGTTACCGCGAAAACCTGACTCTCGGTCAAATCAAGACATTTCTGGA
GATGGAGAGTCATGAGGAGCGCATACAAGAAATCATCGCGCGTGTATGGATGCCCTTTTGTCATTATACGTACATCGGTC
ATCGAATGTCGTGCTGATGTCTTCAAACAGAACAAAGAACTCGAGGCTACAGAGGAGCGCAAACGAAAAGCCAAGCAGTT
GGAACTGCAACGCAAGGATACTGCACGACGAGGCGTTAGTAGTGCGCCTCGCACTCCTGTCTATCCCACGTACAATGCTC
CGACACAGAACACGGCTACAGACTCGTACGACTCGTACGAGGCCGAGAAGAAAAAGGCCCGGTAAGGACAACCAATTTGC
AGCCGTGTTTACATGATAGTCGAGAGAAACTAACTTGGCATGAACTCGGTTAGTCCGGCAGTGGCTCTCAAGGGCAAGGG
GATGCAACTGGGCAAGAAGTCGAAGACTACAGACATGTTCGAGCGCGTCCGCGGCGACCTGGGGCCCGAGGCCGAGATTC
CCGTAGCCGCCGCCCCAGTAGCGACACCAGCAGCCGATCTGGCGGCCTCTGGACATCTGTCGACCGCATTGGACCACGAC
GCCATTCACATCACCGTCAACGAGACAATCAACGCAAAGTTGGCACGCGAGGGCAGTGTGACCTCGCTAGCCGTCACCGG
CGATCTCACCTTGCGCGTGTCGGATGTCTCGCTCACCAAGATCAAGCTTAACCTTGATGCGCACCCAACACACGGCGCAC
AATTCCGGACGCACCCCAATGTCGACCGCAATCTGTTCAATGGGACCAAGGTGATACAGATGAGCAACACGGCCAAGGGC
TTTCCTGTCAATCAGGCCGTAGGCGTGCTGCGATGGCGGGCGGCTCCGAAGACAGAGGACCCGTCAGCTCTTCCCATCAG
CTTCACCGTCTGGGTGAACAAGGGTGGTGACGGTAGCTCCACTTTGACGGTCGAGTATGAGCTCACTGGCGGTGACCCAC
TCAAGGATGTGAGCGTGGTCATCCCGTACGCAAGCGCGGAACCCTCAATCTCGAGCTTTGACGCCAATTACGAGGTGTCC
GGCGACTGCCTGGAATGGTCGATCGGCTCGGTGGATGAGAGCAATCCGAGCGGGACCTTTGAGTTCGAAGCGCAGACGGA
CGACGAGAACGACTTCTTTCCCATGCACATTCGTTTCTCCAAGTCGGCACCTTTTGTGGACGTTGACGTAAGTTTGCCTG
TTTCTGCTATAATTTGTCCTGCCGGTTTACTAAGTATTCGCTCAATAGGTCACATCGGTCGAGCTGCTGGAAATGGGCGA
AGAGGTCACATTTTCCAAGGAAATCAAGTCAGCGGCAGATTCTTTCCTGATTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62