GenePrediction:GLEAN_2725 Details

Name: GLEAN_2725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2887353..2891364 (+ strand)
Length: 4012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2887353..2887630 (+ strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_140:2887734..2888163 (+ strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_140:2888229..2889377 (+ strand)
Length: 1149
Type: CDS
Source: GLEAN
Position: GCSC_140:2889440..2890320 (+ strand)
Length: 881
Type: CDS
Source: GLEAN
Position: GCSC_140:2890741..2890839 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_140:2890909..2890978 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:2891035..2891364 (+ strand)
Length: 330
>GLEAN_2725 class=GenePrediction position=GCSC_140:2887353..2891364 (+ strand)
ATGGCCCAAGTTCCCATGATCTCGGTGCCGCTCAAGGCCACAAACGAGATCGATTGGGTTCTCCCGCTCAAGTCATACAT
CCGGGACACCTATGGCGACGACCCCGAACGCTATGCAGAAGAGTGTGCTACCCTCAACCGCCTCAGGCAGGACATGCGAG
GTGCCGGCAAAGACAGCAGCTCCGGAAGAGATCTACTCTACCGGTATTATGGCCAGCTAGAGCTTCTCGATCTGCGGTTT
CCAGTCGATGAGCAGCACATTCGTATCTCGTTTACTTGGTGCGTTAGCCCATTCATGAAGCGCGCGGTGGCGGTAGGGCG
ACTACTTGAGGCAGTCATGTCGTGCTGGACATACAAGGACGGTCCTTGCTAACTGGGCCAGGTTTGACGCATTTACACAC
AAGGCGACCTCTCAATTTTCTCTTGCTTTTGAAAAAGCGTCTGTCATATTTAACATATCTGCCGTCTTATCCTGCCATGC
TGCTCTTCAGAACCGTTCCGAAGAAACGGGCCTGAAAACTGCCTATCACTCCTTCCAGGCGTCTGCCGGCATGTTCACGT
ACATCAACGAGAACTTTCTCCACGCCCCCTCCGCAGATCTCAGCCGGGAAACGGTGAAGACACTGATCAGCATTATGCTG
GCCCAGGCGCAGGAAGTTTTCCTCGAAAAGCAGGTTGCCGATCAGAAAAAGGTTGGCCTTCTGGCTAAACTTGCTAGCCA
TGCCGGCTCTCTTTACAGCCAAGCTGTCGAGGGTGTACAAGGGAATGTCGAGAGAGCCATATTCGAGAAAGTTTGGCTCT
TATTCGTTCAGGTACGACTCCACGTCACATTCGCTACTCCATAATCCACTCTTGCTAAGTATGCATTTCCGATTAGATTA
AAGCCAACTTGATGCACTCCATGGCACAGTACTATCAAGGTTTGGCTGACGACGATGCAAACCACCATGGAATTGCAGTC
GCACGCCTGCAGCTCGCGGAAGATTTGGCAAAGGATGCAGCTAGAGCTGCTAGCAGCTTCCCTGGCTCCGTGCCTTCAAG
CTCGAACCTGGGGGCAGATACGAATGCCTTACTAGTTGGTCTAACTAAGAGGCATCTGGTGACAGTCCAGGACAAACTCC
GCGGCATGACCAAGGATAACGATTTCATCTACCACGACACCGTACCCGACTCCTCGAGTGTGTCTCCTGTCGCTAAGCTG
CCGGCTTGCAAACCAATACCCGTCAGCGAGCTCTACGCAGGACAGGACATTCAGCGAATTACAGGTCCTGACCTATTCTC
CAAAATCATACCCCTGGCTGTCACAGAATCCGCAAGTCTTTACGACGAAGAAAAGGCCAAGATTGTTCGTGCTGAAACCG
AACGGGTGGACACAGCAAACGGTGAGATGGAAGCCAGCCTTGACTACTTGCGTCTCCCCGGAGCGCTGCAGGTGCTCAAG
GGTGGATTCGACCAAGACGTGCAGCCGGATGAAGAATTTAGCACCTGGTGTGTAGACGTGGCCGATCACGAGGACCCCGA
CATGATCTTCGACTCGTTGCGCCGGGAAAAGGATGCAATCGTAACCATGCTCGACAAGAGCACGAAACAGCTAGATATGG
AGGAGAGTGTTTGCGAGAAGATGAGATCCAAGTACGAAAGCGAATGGACTCAGCAGCCGAGCTCGAGGCTTACAACTACG
CTTCGCAATGACATCCGGAATTACCGAGAAGCTTTGGATGAGGCATCCAAGAGCGACGGTATGCTTGCCACGAAACTTCG
GCAAAATGGAAGCGAGTTCGAAGAGATGCGCTCTGCAGCACAACACGGCGAGATCGACGCCTTCTTCCACCGCGCCTTCT
CCAAGGTGCGCGGTAAATTGAGCAGCCAGAACACTAGCCCAAGCGAGGGCAATCTGCTGGATGCCGATTTTGAAGACAAC
AGTCCCAGCGTACCGGACCAGATCGGAAAGGTGGAGGATATCCTTTCAAGTTTGAATCTTGTCAAGCGAGAACGAAACCA
GATCCTCAAAGATCTCAAAGACAAGGTAAAAAAAATAGCCCGTTACACACATGAAGAGTTTCTTTGTAGCTAACTGCCTC
TGTCTAGATTCATAACGACGATATCTCACAGATTCTGATTCTGAACAAGAAGGCCATTGCGAATTACGAAAGTCAGCTTT
TTAAGTCTGAGCTGGAGAAGTTCCGCACACATCAAAACCGGCTTATTCAGGCAAACCACAAGCAGGCTGCACTCTTGAAG
GAGCTGACAATGGCCTTTAACAGCCTGCTACAAGATAAACGTGTCCACGCCGAGCAGAGCAAATACGAATCCATTCAGCG
CCAGCGGTCTTCAGTAATCAACAAGTACAAGCGCGCTTACCAGGAATTTCTCGACCTGGAGGCAGGCCTGCAGAGCGCAA
AGCGGTGGTATACTGAGATGAAAGAAACGGTAGAGAGCCTGGAGAAGAACGTGGAAGCATTTGTGAACAACCGGCGGTCA
GAGGGCGCACAACTCCTGAATCAGATCGAGCAGGACCGCGCCGCCAACAAAGGCGCCCAGGCCGAGCTGGAGCGAGATCG
GTTGCGTGGCTTGATGGAGCGGATGAGTCTGGAGAAGTCGACGCCATCACCGCCGAAGCACAGTCAAACGTCTTCAATCT
CTGGCCCTGCAAGTGCCAGCAGCCGGCCGACTCCTGCACCACTGTACCTGTCCAGTGCTTCAACACCCCAGTACTCACAA
GCACAGTATCCGAGCCAATATCAAATCCCAACTTCCCCTCCCGCCAACCAGGGCGCTATGCCATCGCCATATGCGACGCA
GTTCGCTCAGCACGCATACAATCCTAGCGCACACGGCCGCATTCCAGGACCGGCGTCGCCACCACCTACAGTCACAAGTT
TCGGTGTCAATGCGATGCGGCCGGTGGGACCAACCTCTCCAGCGCCTACTCAGACAACATTTGGCCAGCCGGGCAACCAG
TATAGCACGTATGGAAACCAGCAGGCCGTGACACCAGGCTATGGATTTATGCCGCCACCTCCCCCTCGAGGGCCTCCTCC
ACTGGGTCCTCAACAGACTTATCATGTTGGACAGTCTGACTATTACAGCCAGCAGCAGCAGCAGCAACAGCAGCCGACAT
CACAAGATCCGTGGGCTGGGCTGAACTCGTGGAAGTGATTGCAGAGTGGCTGGATGTAGAACTGGTGGCACGGAAAATGT
GATTTATATATTATATAGTATCTATATCTCACATCGGGTAGAATTCAATCACTGTTCATTGTTCAGTAGTTAGGCCCCCT
TTTTCCCATTATGTAAGGCAAAGCCGATTTAGTGGGGCCAGAACGTTGCTCGTAAAGGCGGATTGTTCGGTACAATGCGA
TAAACCTGCTCTCTAATGCACCTCGCAGGTCGGACTTCCCAAGAACTCGTGACGTCCAACGGCAGCAGACAGACGTGCTG
GGTTTTACATCCGCGATGCTTTCGTTTATCTTGATCCAAAACCGGCAGTGAGTTTCTGGTGCTGCTGGCACTTTCCCGAA
CGCATCAGCGCTGACAATCCCCCTCCCCCTTTACAGAGGCAAGACGCGGCTTGCCAAATGGTACGTTCCGTACTCGGACG
ACGAGAAGATCAAGCTCAAGGGAGAGGTAAGACAGTGGTGGTGATGGGGATGTGCGGGCGGCCTTGGGCTGACTTGATGC
AGGTCCATCGGCTTGTGGCGCCGCGCGACCAGAAATACCAGAGCAACTTTGTCGAGTTCCGCGACCACAAGGTGGTGTAC
CGGCGCTACGCGGGCCTCTTCTTCTGTGCGTGTGTCGACACGAACGATAACGAGCTGGCGTTCCTGGAGGCGATCCACTT
CTTCGTCGAGGTGCTCGACGCCTTTTTCGGCAACGTGTGCGAGTTGGATCTCGTATTCAACTTTTACAAGGTGTATGCCA
TCCTGGACGAGGTCTTTCTGGCCGGCGAGATTGAGGAGACGAGCAAGCAGGTCGTGTTGACGCGATTGGAGCATCTGGAC
AAGCTGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62