GenePrediction:GLEAN_2726 Details

Name: GLEAN_2726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2894223..2895464 (+ strand)
Length: 1242
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2894223..2894267 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:2894358..2895464 (+ strand)
Length: 1107
>GLEAN_2726 class=GenePrediction position=GCSC_140:2894223..2895464 (+ strand)
ATGTCCAATCTTCTGTCTCTGGTCGGCTGGAGCTTCCTGCCCGATGTGAGAGCGCAGACACCGCCCCAACGCGCGTCTAC
TCTGATCGCCGTCCATTGACTGACCTGCTCTCCTTCTCTCTCTCTCTCTCTGCAGCTCGTCACCGGCTGGACCCAGTCGC
TCTACTACTCGCTGGCCATCCGTGCGGGCGAGCCCCATCCGCGGCCGGGCACGCCACGCTATGCCGAGCACCGCCGCCGC
ATCCACATTCTCGTCGTGGCCATCTATCTGGCCTACACCGTCTACGAGGCTGACTACGACCTGCAGCGGGCTGGCTCCTT
ATACGGCGACCTGGGCGTGCCGCTGACGGCATCCGAGCGGGATATCAAGTCGCGTTTCCGCCGTCTGGCCGCGCTGCACC
ACCCGGACAAGGTCGCGGCCAGCAGCAGCACCGACAACAACGCCGTCAACGCCTACTTTGTGCACCTCAAGACGGCATCG
GACATGCTGCTGGATCCGGCTCGCCGCTTCGCCTACGATCGCTTTGGGCCCGACGCCGTTGTCTGGGCTTCTGCCGGGCC
GCCGCTGCGCTGCGTCTCTGTCCGCGACTTTGTCGTTCGTGGCCTCCGCACTCTCTTGCCCTACTACGGCGCCGCCGTGG
TCGGACTCTACCTGCTCGGCCTGCTCGGCTACCTTTCGGCTCGCGGCGCCTACGAGCGCTGGCTTGTTCTTGCCTGCGTT
TTCGTCTTTGAGCTCCACGCCGTCTCACGCCCTACTCACCCGCGCATCCTCTCCGCCTTCGTCAACCCGACCCTCGCCCT
CGTCGCCCCTAAACACGCCCCTCTGCTGCCCTTTCAGGCCGTCCTGCTCGCCCGCAAGCTGAGCGTCACCCTCTTTATCG
GCCTCTCCCGCATCGCCCCTCTGCTTAGCGCCGACACCCGCTCCGGTCAGATCGTCGCTGCTGATGCTGCTACCACCGGC
TACAGCTCCGACAACGGCCCTAATCAGGCTGCCCTGCTAGCTGCCGTCGACCGCCTCGATGCCGTCGGTCGTGCCCTCGA
CACCGATGCCGCCCGCCTGCTCGAGATGGAAATGGCCCCCTTTGTCGGCCAGGAGGACGTCCTCAGCAATATGCGCGGCA
AGATCAAGCAGTGGCTCGTCCAGAACACGATCCGTGCCGATCCAATGGTGCGCGACGCCGTCGGCCGGTCTCTGCAGCGA
CGACGGGCAGATGCGCCGGCTGGAGCACGTGGCACGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62