GenePrediction:GLEAN_2727 Details

Name: GLEAN_2727
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2901588..2902870 (+ strand)
Length: 1283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2901588..2901609 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:2901668..2902767 (+ strand)
Length: 1100
Type: CDS
Source: GLEAN
Position: GCSC_140:2902829..2902870 (+ strand)
Length: 42
>GLEAN_2727 class=GenePrediction position=GCSC_140:2901588..2902870 (+ strand)
ATGCTCATCGGCATCTGCGGCAGTATGGCACACACACCCATCCTCTCGGCAGCAGCCGGGTTGCTGACATCCCAACTTAG
GCATATGTGCTGGCAAGAGCACGGTGGCCCAGTACCTGGTGGAATGCCATGGCTTCACCCGCCTCTACATTGGCTGTGAG
GGGAGTGCCGCAGACGCCTCGCCGGTGAGCTCGACGTCCTCACCGACTGTCTTTCCGTCTGCCGGGACGCTGCTGGACTT
TGTCACCACCCGCTGGCGCGAGCGCTGGGTGACCACAGACGTTGCCGGCGAGGCCACGCTGGACGTCCTCGTCGGCCGGC
CCTTCTTTCTGCTCATCAGCGTCGACGCCCCCCTGGCGGTGCGGTGGCGCCGAGCCCAGGCACGGGCGGTGAAGAGCGGA
GGAGGCATTGCCGACGAGGACTCTGTCTCGCTGGACGACTTTGTCGTGCAGTCGGACCTCGAGCTGTACGGCGGCGGCGA
CGCTAAGCACCCGCCGCTGCTTCCAGTCATGGCCCGATCAGCCATGCGGCTCGTCAACGGGGCGCCTGGCGGGTTCTCTG
AGGCGTCACAGGAGCCTGTTACAGGGCCTTCTTCTTCTTCTTCCTCGGCTCTCTCGGCTTCCCCGACGCCTGCTCTACCG
TCCTCAGCTGCATCGCCCCCCACCATGGCCACGTTGTTTGCTGCGCTTGAAAAGGCGGGTCTGACAGCCGCCGGCGTCGA
GCAACTTCTCCGCCCTTCATGGGACCGCTACTTCATGTCACTGGCGTCGCTGGCCGCCCAGCGCAGCAACTGCATGAAGC
GTCGAGTCGGCTGTGTGCTCGTGCGTGAGCACCGCGTCGTCAGCACCGGATACAACGGCACGCCCCGTGGCCTGCGCAAC
TGCGGCGAGGGCGGCTGTGGTCGCTGCAACGGAGGTTTTGGTGCTGGCCTCAGCCTGGCCACCTGTCTCTGTCTGCATGC
GGAAGAGAATGCGCTGCTGGAGGCCGGCCGCGAACGCATCCCGACGGCGTCGCTGGCCAACACCATCCTCTACTGTGATA
CGTGCCCCTGTCTGACGTGCAGCATCAAGATCGTGCAGGTCGGCATCGGCGAGGTCGTCTACAGCCAGGGCTACAGCATG
GACGCAGACACGGCTGCCGTCTTTCGCGAGGCTGGCGTACAGCTGCGGCAATTCGTGCCAGTATGTTTCTCCTCTCTTTC
AGTCCTGCAAACACAATCACATACTGACATCTTCATTCTAGCCGGCACAAGGCCTGATTCACTTGGAGAAGATCGAGTTG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62