GenePrediction:GLEAN_2728 Details

Name: GLEAN_2728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2908258..2909210 (+ strand)
Length: 953
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2908258..2908419 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_140:2908477..2908767 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_140:2908845..2909210 (+ strand)
Length: 366
>GLEAN_2728 class=GenePrediction position=GCSC_140:2908258..2909210 (+ strand)
ATGGCTGGCCGGCTCTCTCCAGCTGCTTTCCGGCTGGCTGTGCGGGCGGTGTGTGGGGCCTCGTCGCCGTCGGCCGTGGG
GATGGCAAAGGCCGGCGGAAAGCCCATGCAGATGCGGGCTCTCTCGGCTTCGGCGCGGCGGGCCAGCGCGACACTTCAGG
TGGTGCGTGTCTGATGCTCCCATGGCGGTCTCTCGTGTTCTTGACTGACGGCTGGGCAGCACCGCAACACGGCCGACAAC
AACCCCGACATCCCGTTCCAGTTCTCGGCCGACAACAAGAATGTGATCCAGGAGATCCTCAAGCGGTATCCGCCGCAGTA
CAAGAAGGCGGCAGTGATGCCGCTGCTGGACTTGGGCCAGCGGCAGCACGGATTCACGAGCATCAGCGTGATGAACGAGG
TGGCGCGGCTGCTGGAGATGCCGCCGATGCGCGTGTACGAGGTGGCATCGTTCTACACAATGTACAACCGCACGCCGGTT
GGCAAGTACTTTGTGCAGGCATGCACGACGGTGAGTGCAGGCAGTCGATACGGCCGAGAGGAGCGGCCGCACCAGACAGG
GCACCGAAGCTGACTTCCTGCGACCAGACGCCATGCCAGCTCGGCGGCTGTGGAAGCGATGTGATCGTCAAGGCCATCAA
GGAGCACCTGGGCATCAAGCAGGGCGAGACGACGGCCGACGGTCTGTTCACGTTCATCGAGGTCGAGTGCCTGGGTGCGT
GCGTCAACGCGCCGATGATCCAGATCAACGACCACTACTACGAGGACCTCACGCCCGAGACGGTCAAGTCGCTGCTCAGT
GGCCTCAAGGCGGCCGCGCTCGACCCGTCTGGCAAGACGCCCGAGCCCAAGGTCGGCCCGACAACCGGCCGGCACTCGTG
CGAGAACAGCGCCGGTCTGACATCGCTGACGGACAAGCCGTGGGGTGTTGAGACTACGCGGAGCGATCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62