GenePrediction:GLEAN_2729 Details

Name: GLEAN_2729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2912906..2916217 (+ strand)
Length: 3312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2912906..2914802 (+ strand)
Length: 1897
Type: CDS
Source: GLEAN
Position: GCSC_140:2915004..2915363 (+ strand)
Length: 360
Type: CDS
Source: GLEAN
Position: GCSC_140:2915538..2916217 (+ strand)
Length: 680
>GLEAN_2729 class=GenePrediction position=GCSC_140:2912906..2916217 (+ strand)
ATGGCACGCTCACGCAGCGAGTCGTTTTCGGACGACGACCTGCTGATCGTGAGTTCGCAAGCTGTCAACTCGATACCTTC
TTCCCCACCGCGGCAGAACGCAGGACTGGACAATGTTATCGACATCACCAGCAGTCCGGCAGTAGCCCTCACGCCTGGAG
CCAGAACTGCGGGCGACAGCGGCAGAAGCATCAATGCCGGGACAGCGCGGCCTGTGTTTGGTAGGCCGACGCAGATGACG
CCAACGGCGGCGGCACGGCAAAGGGACAGCGTCCTCTTCAACAACAACAAGAACCGACCTGAGCACCACCGTCCCCAGAG
AATCACGGGTCCGTTGGCGCCCAAGCACGCAGACCGCAAGGCTGCTCCGAAGCCACTGTTCTCGTCTCTACCCAACGGCA
ACACAAGCTCTTACCCGGTAAGCTCCTTCTACGACAAGCAGCAGCCGAAGACGACGGCGGCGGCACATGCGGACGTGGAT
TTTTACGTAGACCCAAACAAGGCAAGCGAGGACCTGAAAGCGCTTCTGGAGGGCGGCATGGAGGATGACGAAGAAGAAGA
GGAGGAGGGTGGAGGCGGAGGCGAGGAGGGAAAGTCAAAGGAAAGCAAGGCGAAGAAGGTGGTGGAGGGACTGGAAGATG
GGACGATTGCCGGGATCAAGGTGAAGCTGTTGCCGCATCAGGTCGAAGGCGTGCAGTGGATGAAGGGCCGCGAGCTGGGG
CCAGTCAAGAGGGGTCGAGTGCCAAAGGGCGGCATTCTGGCCGACGACATGGGATTGGGCAAGACGCTACAGGCGATCTC
GCTCATCATGACGAACTCGCGGCCAGAGCGCGACGGGCCTGGGTGGAAGAAGAGCTACGAGCGGGTGGAGAAGAGCACGC
TGGTGGTGGCTCCTCTGGCACTGATCCGGCAGTGGGAGGCGGAGATCAAGGACAAGGTGTCAGGCGGACGGCGGTTGAAG
GTATGTGTGCACCACGGGCCACAGAGAACGACACGGGCGAGCGATCTGGCCGAGTTCGACGTGGTGATCACGACGTACCA
GATCCTGGTGTCGGAGCACGGGCACTCGAGCGAGGCGCTGAAGAGCGGCTGCTTCGGCGTCAACTGGTACCGGGTGATCC
TGGACGAGGCGCACTCGATCAAGAACCGAAATGCCAAGGCAACCAAGGCGTGCTGTGCGCTCTCGGCAGAGTTCCGCTGG
TGTCTGACGGGGACGCCGATGCAGAACAACTTGGACGAGCTGCAGAGCCTGGTCAACTTTCTGCGCATTACGCCGTACGA
CAACCTGGCGGAGTGGCGAGCCCACATCGACCATCCGCTGAAGAACGGACGGGGCTACCTCGCCATCCGACGGCTGCACA
GCCTGCTGCGCTGCTTCATGAAGCGACGGACGAAGGAGATCCTGAAGGAGGAGGGCGCGCTGGTGCCGGGCGGAAAGAAG
GCGCTGGACGCGGCGGCGGCCTCGAGCGAGACGCCGACGTCTGGCTTCAAGATCACAGAGCGCAACGTGGTGGAGGTCTC
GACGGAATTCTCGGTGGCCGAACGGCGGTTCTACGACCAGCTGGAGGAACGAGCGGACAAGAGCCTGGAGAAGATGATGA
AGGGGTCGGCGATGAGCTATGCGAACGCGCTGGTGCTGCTGCTGCGGCTGCGGCAGGCCTGCAACCATCCGGACCTGCTG
AAGCAGCAGCTGTCGCGAGACAAGGACGCGCTGTCTACGGAGCCGGCACCAAAGGCGTCTTCGGCCGGGGGAGACATGGA
CGATCTGGCCGACGCGCTGGGCGGTCTCGGCATCCAAGCGAAGCGATGTGAGGTCTGCATGGCGGAACTGTCGCGGGCAG
AGCAGACGGCCTGTGTTCCGGGCGACGAGCTGGTGTGTTCAGGTTGTCTGGCTGACCGTGAGATCTTGGGAGAGGGAAAA
GAGAAGAGGAAGGAGAGGAAGGAGAAGAAGGAGAGGAAGGAGAAGAGGAAGGAGAAGAAGGAAAAGAAGGAAAAGAAGGA
AGAGGAGAAGGTGAAGAAGGAAAAGGAGAGGAAGGAGAAGAAGGAGAGAGAGAAAGAGGAGGAAAAAAAGGAAAAAGAGA
AAAAGAAGAAGAGCAAAGGGAGCGACCGAAAGGACAGGTCAAAGAAAGACAAGGCAAAGAATGGGGACGACGAGGCGCTG
GTGAGAGCAGTGCGGAAGCCAAGAAATCGACGCGCTATTATCGACAGCGACGACGAGGACGAAGAGGAAGATGGCAGCTG
GTTGGTGGGCGAAGAGCAGAGGGGCTCATTGCGTCTGGGCAAAGCAGGCGGCTCCGAGGACGAGGATGCCGAGGGGGGAG
GCGACTGGATCGAGAGCGACGATTCCATCCACCACTCGGAGGACGAGGACGACGGCAGTCGGCTGAGCAGCTTTATTGTG
GACGACGAGAGCGGGAGTTCAGACGAGAGCGAGACAGAGATTGGAAGTGACAGTGAAAGTGAAAGTGGAAGCGAGAGCGA
AAGCGAGAGCGAGAGCGACAGCAACAACGACGACGACAGCGACAACGACAGCGACAGCGACAGCGATGCCAGCACTGCCA
GCACGTACAGCAACTCGCTCGCGTGGTCGGCCAAGATCCGCAAGACGCTGTCGATTCTGCGGGCCGAAGCAGACGAGCAC
AAGTTTATCGTCTTCTCGCAGTTCACCTCGATGTTGGATCTGTTGGGACCCTTTCTGGAGCGAGCGGGACTAGGTCACGT
GCAATATGATGGCCGCATGCGCAACGACGCGCGCGAGGCCAGCCTGCGATCGTTGCGCGAAGACGCGGCCACGCGCGTGC
TGCTCTGCAGCCTCAAGTGCGGTGCGCTTGGGCTGAACCTGACGGCGGCCACGCGGGTCGTCATCCTCGAGCCGTTCTGG
AACCCATTTGTGGAGGAGCAGGCCATCGACCGGGTCCACCGCCTGACCCAGACCGTCGACGTCACCGTCTACAAGCTCAC
CATTGCCGACACGGTCGAGCAGCGGATCCTCGAGCTGCAGGCCAAGAAGCGTCTGCTGGCGGCACACGCGCTCGAGGAAT
CGGCCGGCGGCAGCCGTGGCGGTCGTGGCGGCAAGGGCGTCAACAAGAAGGAAGCCCTCAAGCTCGGCCTCAAGGAGCTC
ATGGATCTGTTCCGCCACGACGCCCGTGGCCAGCCGGGCGACCCCGACGATGTGCCCGGCATGGCCGGCCCGCTCGAACC
CGTCGTCGACGGCGGACTGCTGCGACGCCGAGACCCCGGCAGCAAGCCGGCCGGAAAGACGGCTGCCGTCGACAAGCTGC
CGCAAAACTCGGCCTACAGCCGGCGATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62