GenePrediction:GLEAN_2739 Details

Name: GLEAN_2739
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2964042..2969978 (+ strand)
Length: 5937
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2964042..2969289 (+ strand)
Length: 5248
Type: CDS
Source: GLEAN
Position: GCSC_140:2969356..2969532 (+ strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_140:2969725..2969978 (+ strand)
Length: 254
>GLEAN_2739 class=GenePrediction position=GCSC_140:2964042..2969978 (+ strand)
ATGCCGTCCGACGAGCCGAACGCGACGTGGCATCCGGCCTTTATGCCGGCGTCTGCAGCGGAAGCCCCGGCAAAGCCAGC
TTTAGCACCGCAGGCCCTAGAGGAGAGCAATGCCTCGCACACGGCTGACGAGGTCGTGGCCGACGGCGTGGCCGAAGCCG
AAGCCGAAGCCTGTACTGCCGACCACGACGAGACGGCTGCAGATGCCTGGTTTCCCGAGTACGATGCCAGCAATCCGTGG
ACCGGGCAGCTCCGTCATGCCGATGCGGACATGTCCAACACCCCGGTCGATCACGATCAGGCCACTGGTGCGACGGCCGA
ACCGTCGGCCGAGCCTGTTGTGTCCGACAAGGCCAACAAGCACATGAGCACCGTTTCCTTTACGCGAACGGTGTCGAACG
AGGTCAATTGGGATGCCGACGATGACGACAACACCGAATGGAGCCTTTCACGGGCTGACACGGACCCTTTCAAGTTCATG
TCCCCAACCGATCGGACAAACTCCTTTCCCGTCGTTCCTGCCCTCGACACAATGCCTGCAGACGAGCAGTCCGACCGGAG
CCTCGACCATCAGCCGCTGACGTCCAACGAGGCCTCGGACATCATCCAGGAAGTTGACCAGGAGGTTAGCCAATATGCCG
AGCTGGAACCCAGCCATGCCGATGCTCTGCTCGACCACAGCTATGCCGTCGACCATGCAGCGGCTGCGTCTGATGATGCT
CTTGGCATTCGCTTCGAAGAGGGCGTCCCGCTCATCTCCCACGACCACCACCAGGCTGCAGAGCCAAGTCCGCCGGAACA
CAAGGCTGATGATCCTTTCGGCGAAGAGGCGATTGACGAAGACGACGACTTTTTCAATCACGCTGGACCGTCAGACCGTG
AGCCAGCGGAGATGTCGCCGAAGCCTGCTTTTGAGCGAAAATCGACAATACAGGTTCTGCAGGCGATGAATGTGGGCGCA
CTGGGCCACAACAGCTCAGATTTGGCCGCTGCCATGGAGGAGGAAGAAGAGTCTGACATCGCCGCACAGGTCCCGAAAGC
CAGCAGCAAAGACCTGGCTGCTGAGTGGGCTGCTGCTCTCGCCAGCGACGACGAGGACGAACTGCTCATGGACGACTCTG
TGCTGGAGACGGACAACAAGGAATTGGATCCGGCTGCCTTTTTTGAAGACGACGACGAGGGCTTTTTGGATGACGAGGTC
CCGGAAGTGCCCCAGGTCAACGGGTCACAGCCACAACCAACCGCCAACCGATATGTTCCAGCTGGCCCGCAGATGGTCCA
GCCTCTGCAAACGCCACAGCCGGCGAATCCATACCTGCCGACTACTACGTTTTCTCCCGCCCAGCCTGTCGTTCCGTCCC
CGTTTGTCACTCCTGGGCCGCCACCCAGCCAGTTTCCGCTCTATGGTAGCACGCCGTCTCAGGAACGGCCTGCTCCAAAG
GCCCAGAGCTTTGCCGACAAGTCCAAGGGTGGGTATCACTCGCCTTACGACCTTCCCATGGACGTTGTGAAGCCGAGGAA
GCGGCCGAGCATGCAGCACCTGCCCAGGACTGTGGAAGCAGCCTCTGCCCCGCCACCGGGACCCCCTATCCTGGCCCGGA
GTACCAGCATGCAGACGCTGACGCTGCCGTCTGTTCTTCAACCGAACTACGAGCAGTCTCCAGCCGCGCCACTGCCGAAG
GCTCAGGCGACTCCTTTGAGTGCTCCTGTCATTGCTCCTGTTCATGAGAGCTTCTTCGAAGAGCTGCCCATGGTTTCCAA
GGCTCGGCCAGCATCTCGGCATACCCACGGGTCACCGGTTCCGGCCAGTCCATATGGACCGCCGCAGGCCGCTCCCATCC
ACCCGCCTCCCCAGACGACGCCGCCTGCCTTCTCTCAGCCTCCACACACGCCTTCATTCGCACCCCCGCAGGCTCACTAC
TCACCCGCGCCGACACCAGCACCCCCACAGGAACAGCCAGCGGAACAGACGTCGGGCACTCCTGACATCGTCCGGCTGGT
GGCACCGCCACGGACGAACCCATACGCATCTACTGTATCCTCGAACCTGGCGCCCCAGAGCGCCGCTTCTCCGCAATTGT
CGCGGTACTCTCCCTCGCCCAACATGACGCTTCACGCAAACGGCTCCGCCCATGTTTCGCCACCGAGCCGATACTCTCCT
GCACCTGTGGCCCGGACGCCTTCGACTGGCTATGCACCCATCCCGGCTGGCGTGCCGCCGCCCATACTCGCCCACCAGCC
GCGGACGTCCAGCCCGCTTGCCCACTTCGAGATGTCCTACGACAAGCCAAGGAATGCGTCTCTCGGGCATCCGATTATCC
GGGGCGAGAGCAACCTGCCGGAACGGCGAAGCAGCTCGTCTGCGTACGACCCGCGTCTCAATCGGGTCCCATCGCTGCCG
CCCACACGAGAGGTGGAAGAAGATGAGTCCCAGGCGCGGCCTCCTACGTCAAGTATGCCGAATCCAGCGCCACCACCGAC
GAACCAATATTCTCCTCAGAAATCCCGACAGACGCCACCGCCGCAAGCGAGCTCATATGGCCTGTCGACCCAGACGCTGT
CGCCTCCGAAGCGGATACTAAACTACACGCCGCACAGTGACCCTATTCCGCAACGTGCTCTCACGCAGTCTCCCGCCAGC
ATGCTTGCCACCCCCCCGGCCCCTAAGCCAGCCGACAGTGCCCCGGCCAGTATCCCTCTCCCGCTTCGTCCTCGAGCTGC
GTCGCAGAACCTGAATCTTGTTCCTCCCACGGACGGAACAGAGCAAGACCCGCTGCAGAGATGGAAGGGGGCGCCGATAT
TTGCCTGGGGGGTAGGCGGCGTGTTTGTGTCGTCGTTTCCACGAGACATCCCACGCTACGGCATCAACCAGGCACTGCCC
ATGTATCATCGTGAGGCCGGGGACGTGCAGATCAAGCACATCAAAGAGATCCACCCGCTTGAAGAACGGCTGGCGAGATT
CCCCGGCCCTCTCAAGGGCAAGTCGAAGAAGAAGGAGGTGATAGCATGGCTCACGGCGGGGATCGAGGACCTGGCGCGCT
CTCTTCCCAGCCAGTCCTTCTCGTTGCAGGTCTCGCACGAAGACAAGCGGCTCGAAGAGAGAATACTGCTGTGGAAGATT
CTCCGTGTTTTCGTTGAACACGACGGCGTCCTAGAGGGCGCCCCAGCGGTGGATAAGGCTGTGCGTGACTGCCTCCTGCC
ATTTGTTGACGAGACTGTCACGGCCGCAGAGGTGCCTGCGTATACGGCCGGCATTGGGATTGCGGGCTTATCGGACGGGC
CGTCGTCGGGGCAGATGCAGTCCGATGCAGTGGACCCAGCTGTGGTTGAGCAGATCCGCAAGAACCTGCTGCTCGGCGAC
AAGGAAAAGGCAGCGTGGGATGCTGTTGACAAGCGGCTCTGGGGTCACGCGTTCCTCATTGCACGAGCTGCATCGGCCGA
ACTGTTTAAGAAGGTGGCGCAGGAGTTTGTGCGGAAGGAGGTTAACACACCGGGACACAACAACGAGTCGCTGGCGGCGC
TGTACGACGTTCTGTCGGGAAATCACGAAGAATGCGTGGACGAGCTGGTGCCGATCCATGCGCGGGCCGGACTGCAGCTG
ATATCGAGGCAGCCAGCGGCGGGCGAGCAGTCCAAGGATGCGCTGGCCGGGCTGGACAACTGGCGAGAGACGCTGTGTCT
GGTGCTGAACAACCGGACGACAGACGACGTGCAGGCGATCAACTCTCTGGGGAACCTGCTGTCGGGGTATGGCCGAGCAG
AGGCGGCCCATGTGTGCTTCCTGTTCTCGCGGAACGTGACGGTGTTTGGGGGTCTAGACGACGCGGCGGCCAACTTTGTG
CTGCTCGGGGCGGACCACAAGCGTCAGGTCGACTCGTTCGCCAAGGAGACGGACGCAGTACTGCTGAGCGAGGTGTACGA
GTACGGGCTGTCACTGGGCGGCAGCGCGGCCGCAACGGGCGGCAGTCCCCATCTGGCGGCGTACAAGCTGCAGCATGCGA
TGACTTTGGCCGAGTATGGGTTCCGGGACAGGGCGCTGCAGTACTGCGAGGCGATCATGGGAGCGATCACGGCGCAGAGC
CGGCGGTCGCCATACCACCACGTGCTGCTAGAGACGGCGGTAGACGATCTGATGAAGCGGCTGAAGCAGGCGCCCAAGGA
GGAGTCCAACTCATGGATTCCGAAGCCAAGCATGAACAAGGTGTCGGACACAATGTGGAACCGGTTCAACAAGTTCGTGG
CAGGCGACGAGGCCGAGGGCGGCGGAGTGCATCCGGACGGCGAGGGAGCAGCAGAGAGCGGACCGTTTGCACGACTACCG
GGCGGCACCCCGACGATCAGCCGGCCGCAATCGTCGGCCGGCCTCACGGGCATGGACATGTTCAGCCCGCAGAGCTCCCA
GTTCAGTCCGACGTTTGTTAGCCAGACGAACGGCGGCGTTGGCGGTTCGGGCATGGTGTCTCCGCCTCCGATGCGGTCAG
CGTCACGCTATGCGCCGGGAGCAGGAGCAGGCGGCCAGTCGGTGACATCGCCGATCTCGGTGACGAGCCCGTACGAGCCC
AACACGACGGGTTTCATGTCGCTATCGGTGTCAGCGCCTGCGGCCGGCGTGCCGAATTTGTACGAACCGCCATCTGCGTT
TGCAGCTTCGGGACGGCGATCTCTGGAGTACCAGCCGGCGGAGGTCAGCTCGCGGCGGGCATCGTCGGAGTTGTCGCCCG
GATATCTGAGCGGCTACAATGCCACGGGAGGCCAGTCGGACTCGGGTCGCAACGGGCTTTCTCGACAGTCGTCATACACG
CCGCTGGTGCAGGTAGAGCCAGTGCTGACGCCAACCAGCGAGGCGCCACGGTCGGAACAGAGACCGGAGCCGAGTCCAGT
GGCAGAGTTTGGTTTCCAGCCGATGTCGTACGGATACGAGCCGCCTTCGTTTAGGACGTCGTTTGGGGCCGGGGCCAGCG
AGGAGGTCGAGACGCGGCAGCCAGCGCAGCCGGTGCAGGAGGAAACGACAAACGGCGGGTATGCGTCCCCGTCGTTCCAG
CCGTACAGCTACGAACCGCCGTCATTTGATGCGGGGGCTGAGCCGGACGCAGAGACATCGAATGGGAACGGCGAGCTGCA
GCGGAAGAAGAGCTTTATGGATGACGACAATGATGGAATTGCCACGAAGAAGAAGCCGACAGAGAAGACCAAAGAGGAGA
AGGACCGCGAGAACGCGGAAATGTTTCGGAAAGCAGCTGAAGAAGACGGTAGGTTTTTGTTCCATTTGGTTCTTGTTGCG
ATGTGAACAGAGAGAGCACGAGCTAACAATTCAGCCAAACGAGCGGAAGCAGCAAAGGCCAAGAAAAAGGGATGGGGCCT
GCCGGCATGGCTTGGCGGTGGGAAGAAGGAGGTGGTGGAGCAGGCGCCCAAAGCGGTTCGGGCCAATCTGGGCGAGAAGA
GCAGCTTCTACTACGACGCGGATTTGAAGCGGTGGATAAACAAGAACGGTGGTTCGGACGAGACGGCCAAAACGACACCG
CCGCCACCGCCACCGCGATCGACCTCGCAGTCATCTACGACGATGGCGGCTGCAACAATGGCTACAACGACGGCACCGAC
GGCAACAACGATGGCACCACCGATGGGGACACCCCCATTGGCATCGCCGCCGATGATGGGAGGTCCACCGATGGGACCAC
CAGCACGACTGCTGCGGCCTCTGGGGGCGTCGCCGTCGGTGCCGAACCTGCGGGCAGTCCGCGGATCCGGCAGCGTGCCA
CCGCCACTGATACGGTCGATCTCAGGGGTCAGCCTGCCGGGCAGTGCGTCGCCAAGTCGGCCGGGAACTGGTGTCAGCGA
GGCCAACAGTATCGATGACCTCTTGGGGGCGGCAGGGCCGCGCAAGCCGCGCAAGGGCCGCAAGACTGGGCGGTACGTGG
ACGTGATGGCGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62