GenePrediction:GLEAN_2742 Details

Name: GLEAN_2742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2987974..2988655 (+ strand)
Length: 682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2987974..2988000 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:2988069..2988532 (+ strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_140:2988595..2988655 (+ strand)
Length: 61
>GLEAN_2742 class=GenePrediction position=GCSC_140:2987974..2988655 (+ strand)
ATGGGGGCCACACTGTCTATGATCAAGGTGGGCAAGGCCTGGCCAACTGATGCCTGTTTAACATGTACCTGGCTGACTTT
CTTCTCCGCTTGCAGACCCTCTTCATCCCCGCCCTGATTGCCCTCCTCGCATACATCATCATTACCTTTGCTGTCATCCC
TCTGATCCGGTTCTACCACAACCGGTACAGCCACTACCTGCCACTCGACACCATCACCACCCAGACATCATCGATCCGTC
AGCGCATGCAGAGCGTGGCCGGTCGGTTCCTGGTGCCGTCTACATGGCAACAGCGGCTGCGCGATCGGGCTGCCGCTGGC
GGCGGCCTAGGCTTTGCCGGTGGCCTCATGGCAGGCGGGTTCCTAGGACGCCAAACGATGGACGACGATACCGAGTTTCT
GTCTGATGGCGAGGACTTTGACCACGACATCAATGGCGGCAGTGAAGGCCTCGTCCTGGGAGAAGAAGGCGAAGAGCTAG
GCGAAATTCGGCGCGGCGAAGCTCTACTGCGTGGCCTCCCGAGCCAAGGAGCCTACAATACAAATCGGCTTAGCAGAGAG
TATGTTATTTTGCTACTTGCGATACCGGTGTACGGCATGTCTGACTGACCCATTTGTGCAGCCTAGAACAGGGATTTATG
GACGACAGCGACGATGACGAGCCGCCAGCACGGCGGCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62