GenePrediction:GLEAN_2743 Details

Name: GLEAN_2743
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2989802..2992303 (+ strand)
Length: 2502
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2989802..2990486 (+ strand)
Length: 685
Type: CDS
Source: GLEAN
Position: GCSC_140:2991027..2991132 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:2991191..2991781 (+ strand)
Length: 591
Type: CDS
Source: GLEAN
Position: GCSC_140:2991878..2992208 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_140:2992277..2992303 (+ strand)
Length: 27
>GLEAN_2743 class=GenePrediction position=GCSC_140:2989802..2992303 (+ strand)
ATGATCTGCTATGTTCCCGTTGGCGTACGAACCCCCGATGGCGAGATCGAGTCATGGTCCGCTTTGCCATGCGGGCACCG
TTTTGGATCCTACTGTGTCAAGCGCTGGCTCGGCCTCGCAGAACAGCCTGCATGCCCCATATGCCGCACGCCTATGGTTC
ACGCCTGTGGGCACCCGGTGCTCCCGTTGCCTACCGTTCCCAGCAAGACCATGAACGGAAAGGCCGAAGAGGATGGATAC
AGCGACAGTGAGAACCGCTTGAGCAAGAAGGCAGCACTCATGTCCCAGAATGCATCGCCAGCATCACATACGAGCTCTCC
TGCGGCAGGCTCCCCCGACGGCTCCACCCTCAGCCGCTCCGTCTCCCGATTTCGTCGCAAGCGGCGTCTCAGTGTTCCAG
GCTCTTCGTCTATTCCAGTGCGGGTTCCGCTAGATACGCAGGCGCCGTGTGAGTATTGCTCCGTGTCCCTGGTGAAGCAG
CAGTCGCATGGCGGACCCCCGGGTGGCGTGGTCCGGCTCGCGTTTCGTGTCTTCACGCAGCATTCGCGCAGCAACAACAA
CAACCAGAGCAACACAGAAAATGCATACTGGGAGCGTTGGCGGAAGGACAACAGCAGAGCCTTTGGAGAGTGGTGGGCAA
CTCAGCAGCCTCCGACAGAGCCAGCACGAGAGCTCCCTACACAAGGTTGGATTATTTAGATTGGATCATACGGCGGCGTC
ATCGTGGTAGCGCCGGATGCTTTACTTGCTGGAGTTGGATTTAGAGAGAAACTTTCTATATATGCGTTTTGATTCTGTTT
TGTCTCTTATTGTTATAATGCTCCTAATACGGTCAGATTGGGCTCTCGTTGTCACCTGGTATGCCTTATCGCAACATTCG
CGACAGCCCGCTGCGGGGCACGTAGTTCCCTAACTAGGCAATTGCAATTTACTAATTACAAGCAATACCCCGCACGATTA
CGTCGTAACAGCAAGTATGCACTAACAGCTCGCGACTTTTCCTAGACGCGTCTATTTTCATTGAAAATCACACCTCCGAT
TAAGGTGGCCCCAAAGTCCCGTAAGAGGACAGGACGCATCGTGCGTTTTCCCACAGTACCACCATGAAGTTTAAAGCAGA
TCTTCGAAACAAACGCACATTTTCAAGTAATGAATGATCCTAACTTTCAGTGAAAATCGGACCTACTTGCTATGTGATAG
ACTAACTCGCAACTCTCGCCTGCAGAACTGGCCGCAGTACTTAATTCGCTCGACAAGATCGTATGGATGCGTCTGGACAA
TGACACTGTACAATTCATTGTAGTTCCAGACAAGGGGTCGGAGGTTTGGTCGTGCGTATCTCTGCTTAGTCTTCTCCCAC
GGTCCGGCAGCCGTGCTAACAGCTGGCAGAACCTTCCGCCGAGAATTTCTCTTCGACAACTATCTGGTCCAGTCCTTGGA
TGCAGGCAATCGTATTGATCTCGAACTTCCCCTGGCTTCTCTCCAGCGCGCCCTCAAGTCTGCCCTGAACAGCACCGATG
CCGTTCTTCGTCTGAGCAAGCACGATGGCGTGCCCGTTCTGTCCATGACCATCCACACCATGGCCAACCCACGGGGCGGC
CTCGGAGGGTTTGGAGGGGGTGGAAGTAGTGGTAGCGGTGCTGGAGGAGCTACTAGTGGGCGAAGACCGGGAAACTACGG
GCGGGAAAACACCTTTGGCGATTCTATCTTTGTCGACCAGGGGACGCAGGGGACGCAGCAGCGGACGCAGGCTGACGAGG
AGACGTTGGAGCTGACGGTCAAGCGAGAACGCGAAAAGGTGGTCGTGCAGGACATTCCGGTACGCGTCTTGCGCTTGGAC
GGAGAGCATCGCACGCTGGAGCCCACAGTGGCCGAGGCAGACGTGAACATCGTGCTACCGCCGCTCATGCAGCTCAAGGC
AGTGTCGGACCGGTTCACGAAGCTCGCCCACACGACAAGTGGCGGCAGCTTTAGCGGATCGTCGATGATGATGGGAAGCA
CGATCGGCGGCCTTGGGGGTAATGGCGGCGGTAGCGGCGGCAGTAGCGGTGGCAGCGGTCCCAAGCTGGAACTCAGCGCC
AACATGTACGGCACGTTGCGCCTGCGGCTGGTGACGGACACCCTGAGCGTGGAGACGGTGTGGAACGACCTGGAGAACCC
GCCGATGAACGAAGAAGCGCTGCCGATGCCGCTGGCGGAACACCCGAGCACCAAGTTCCTTGAGGCTGGACCGGACAAGT
TTGCTACAGTGCTGGTGGACGGCCGGGACTGGAGTCGGGTGCTTAGCGTGGGCCGGCTGGACGGACGAGTCATCGCCTGC
TTTAACGACACCAAGACGTTGGTGTTGCATGTGTACGTGTCGCAGCCAGACGATGCAGACGATGCGACAGAAACAAGCTC
AATCACGGTATGGTGTTATGACTGTGTTTACACGAACCCCTGCGGAAGTGCACCTATGCTAACTATCTTCTCTAGTACTA
TGTAACTTCGTACAGCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62