GenePrediction:GLEAN_2744 Details

Name: GLEAN_2744
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2992789..2999298 (+ strand)
Length: 6510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2992789..2993092 (+ strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_140:2993158..2993265 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_140:2993347..2993396 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_140:2993461..2993985 (+ strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_140:2994239..2994319 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:2994494..2994695 (+ strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_140:2994767..2998638 (+ strand)
Length: 3872
Type: CDS
Source: GLEAN
Position: GCSC_140:2998855..2999298 (+ strand)
Length: 444
>GLEAN_2744 class=GenePrediction position=GCSC_140:2992789..2999298 (+ strand)
ATGGCACTTGCTGGTCCTATCAAACCGGATATTCGTCCCAAGCTTGACCCCGCGTTTGTCAAGTTTTACGAGGAGACATT
GGCGACGAAGCCTGCACTGCATCAGATTCCGCTCGAGCAAATTCGGAGTGACCCCCGTAAATATGCTGCACGATGGGCTC
TGGATGCGCTGCGGGAAGGCTACGAACGTGTCAAGGATTGGGATGTAGCTACAACAGACGAGGCCACCATCAAGGCCAGG
TCGTACCATCCTGACCCTGAAAAAGCCGGCCCAGGGCCGTATCCTGTGCACGTTAACTACCACGGTGCTTGATTTTCCTT
TGCTTCTTTAACTTGGTTTAGTAAATTTACTCGCTAACATCTATGGCAGGGGGTGGGTATATGTTTGGCGATTTGACGAA
TGATGCCGAATGGTGTCTGCACATAAGAGACGATTTACCCTTGGTGATCGTTGACGTCGCCTACCGGCTCTGTCCGGGTA
GGATACTTTTCCTGTTCTTTTCCTTGTATTGCCTGTGCTTAGTACGTATTGTACTTGACTGACCAGTGAAACAAACAGAG
GTCAATTATGGCCATAATATCGAGGATGCATGGTCTGCACTCTTATGGGTATGGATACAAAATACAACAATGGATTCTTA
CTCCCTTAAGAGTATGTTTCTAATACTCGCAGGTGAGAGACAACGGTAAACGGCTAAACATCAACCCTGGTTCGGTCTCT
ATCGGAGGTCTGTCAGCAGGAGCCCAATTTGCAGCCATCCTTCAACACCGGGCTCGAGACATCAAGTTGCCACTGAAGCT
TGCCATTCTTGCCGTTCCCCCAATGGCACCTCATTCTGAATACAGATCGGCTGAGGACTCGCCATTTCCGTCCTTTGCTG
AATTTGCCGAGGGGCCAGTGCTGAGTTGGGAGCTGATAAAATACTTCAACCAATGCACTTTCCCCGAGAAGCTACTTCAA
AGCCTGCGCCAGACATTGCCAGAATACTACTTTAGCCCTCTGGCTGCGCCCAACTTTCGCGGAATATGCGACACTTTCAT
CGCTACCGCCGGCTGCGACCCGCTCAGGGACGAGGGAGAGGCGTATGGCAGAAAGCTGATTGAGGGCGGCTCCAAGGTCA
CCATCAAGAGATACGCTGGGGTTCCCCATACCTTTTTGCACATGACTTCCATCTTGCAACAGTCTGTGGACTATGAGGTA
GACTGCATCGCAGCATTGAAGCAAGCACACGATCTGTAACTGTGGCAGTAGATATGCAGAGAATTGTATCTTATTATCTG
CAGCGCCCATCTGGCAACTGCGGTTAGCGATTCCAGGGGAAGGCGCCACCACTTAAGCCGCTCCTGCCAACGGCGAGTCC
GCCCTGAACGCTCGGGCCACAAACGGCAGGGATATCTTCTTGGTTAGGTAGGGGACTTTGCGGTGTGGCCTATAATCCTC
AAATCGCCAGAAAAGCCGTCGTGAGTTTGAGAACGAGCTTGATTCGCACCTCCCGGCCGGCCAAGACCCGCGAGCCCAAC
GTCGAGCTCTCGTACGAACGGTCTACTTCCCGCAGACACAGAGACCCTAGAAAGAGAACGCACAACAGCCCACAGCCCCG
TCTGTCGGCTCGGACCCTCTCCTCTGCCCACTCGCCATGTCTTTCTCGAAATAAATCTACCCCCCTCTTCTCTTTCGGCC
ACATACACACACGACACACACCCAGACAGAACGGACCGGGAGAGTCACAATGGCGACAATGCAACGGTCCGACCCTTTCC
TGCCCATCTCGCCGGCCCGGGTGAAGGCCTTGGTGCTGCCGGTTGGGCCCATTCACCAAGACCGCTTTGCTTCGTTTCTG
CAACGACTCATTGGCGAAAGCTCCGTGCAGTTACGCGATATCAGCGCGGACGGCCGGCCAAATCGAAGTGGGTGCAACTG
CCTACAGCCCGTCGGATCGATCTGCCGGCTTCCCTGCTGACAGCTATGCTTTCCCTAGACATGTTCAACCCTCTGGCCTT
TCCTGTTGGATTCATCTTCTACGACCTGATCACGCACGTACCCCAGCCATCACACCTGGCACTGACGCCGTTTGACCAGT
ACCGCGAGCCGCTGGTGGTGCTAGCGCTGGCGGATGGGGCGGCCATCAAGAGCGTCTTGTTCGGCAGCCGGCGGCAGTCG
GCGGCCGGACGATCGATCGAAGAGCGCAACATCCGCACACTCTACCAGGAGCTCGAGGCGCTGCGTGACACATATCCGCG
AGTGCTCGTGCACCGCGTGCTCATCTTCGACTACGAATCGTCGCCGGAGACGCCGATCCCGATTCCCGAGGGCATGGCTA
CGGTATCGTCGCCGGCACAGTCGAAGCGCACGACAATGCGGATGGTCATGTGTGACGTGTCGTCACTGCTGCTGGCCGAG
ATGAACACGCTGGCCAAGTCTTTCGAAGCCATGTCCTACATTGAGTCTCCCGCCCAGGCAGGTGGCGGCGGCGGCTCGGA
CGACGGGCATGGCAGCAGCCACAGCAGCCACAGCAGCCACAGCAGCGCACTTCCGTCGCGCCGGAACTCGCAGTTTGCAC
TGCCAGCACACGTCGGTGGCGGCGTGATGCGATCAAGCTCACTGAAGGGCAACGACCACAGCTCAGCTGCGGACCGGTCA
CAGGTACGCATGTCTATGCCGGCACCGGCAAGGGACAGCAGCTCGACATCGGTGACGGGACGGCCGTCGACGCCGGTGCG
CAGCGGGCTCTCCGGGCCTGCAACGACGTTTGACGAGATAGGCAAGACCATACCGAGTCCGGAACGGAACGCGTCACCTG
CGATCAGCGACTCGGCGGATAGCTTCCGGTTCCAGGGCACGCCGATAGGGAGCATGTCCGACCACCGGGTATCAGTGCAG
GGCTTCGGGTCTGGCGGGCTCAACGAGCGGTGGCGCAACAAAGGCAAGAGCCGGGTGACGATAGTGGTGGCATCGCTGTA
CCTGCAGGCGGGACGCTGGACGGATGCACTGAAGGAGCTGATCGACGGGGCGACGGTGTCGCGGTCGAACAACGACCACG
TGTGGCACGGCAAGGCGCTGGAGCTGATCGTGGTGTGCCTTTTCCTGCTGGGCTGGGCAGACATTGAGTTTCAGGTGCCG
ACCATCTGCCTGCCACCGCCGGAAAAGGGGGCAGCAGCAGCGGCGACTGCACACGCGCTAGAGGCAGCAGAGAGAGCACA
CCCGAACCAACCGCGATGGCTGCGCAACCTGCAGCAGATCCTACCGGACCTACTGGAACGGATTCTAGGTCTATACGGAC
GGATCTCAGCGGAGCGGCTGCCGCCCCTGGCAATGGCAGAGACGACGATCCGGTTCTGCAACATTCTGACGGCGCTTCAC
ACAGCGGACGGCGTGTTGGGGCGGGCCTTCCTGGATATTGTGGTGGTGGGACGCAGCAAAGCGGAGGAAATAGTAGCACG
AACGATGTCGCCGCGGCCGGGGGTGGTGCCGGGACGGCCACAAATTCTGACGTCAGTGTTGCGAGCGTTTCCAGCGGCAA
CAGCAGCCGATCTGATGCTGTCGACGGTGGACCGGATTGTGATCCTGAGCGGGATCGCGTCGGTGCTTGGACGGCTGAAC
TACCGGCGCAAGCGGGCGTTGGTGGTGCGTGAGCTGCTGTCGGTGCTGACGGACGGGCTGGTGGAAGCACGAACGCGCGG
AGCAGCGGAACTAGGCATCCACCCGGCAGCAGGGTTGGTAACACCGGGAAGTGGAGGGCAGGGCAGCGGCAGTGGAGTGG
CGCTGGACCTGGCAGAAGGCGACTTGGAGACGGGGGTGGAGGCGTTCCTGGGGCTGCTGCTGCGGACATACGGCGTGGTG
GAGCTGCAGCCGGGCCGACAGACAGACAACGAGACGGCGAAGTCAGTGATCGCAGACACGGACGAGGCAGTGTTCTCGCG
GATCGGCGGACAGGCGGCAGCGCGGCAATTCGGGGTGCCATCACTCAAGATGGACATCTTGCGGGCGTGCATCAACTTCT
CGGAGGCGCTACCAGACTTTGGCGGGGTGGCCAAGTTCTCGAGCGACCTGCTGCGGACAGCAGGCAGCGGGGTGGCACCG
GGACCGCGGCGGGAGGATGCAGCGGCGATGATCACGCGGGACGAACAGGTGCGGCTGGCGACGAACATTGCCAAGGCGAC
GGGGCTGGCACGACGACTGGGGCTGGCGGACGTGGCAGCAGAGTACTGGGATGAGTTCCTGGTGCGGGGAGTGCGGTTGG
AACTGCCACCAGCGCTCTGCGTGCCGGTGGCGCACTCGGAAAGCGAGCTGCCAATCCGAGGCGGCAAGGCAGCGGTGGTG
ACGACGGTGCGGACATCACAGGACGTGGACCCGTTCATCCACAACCCGTTTCTGAAAGCGGTCGACAAGGAGGTGGTGGA
GCAGACACTGGTGGCGATGGAGCCGGCAACGTTCCGGCTGACGCTGCAGAACCCGTTCGACATGGAGGTGGTGATCGACA
GCATCCGGCTGGAGACGACGGGGGTGGCGTTTGAGGCGTTTGAGGAAGGCGTGGTGGTGGGGCCATACCGGACGCAGATT
GTGCGGGTGGGAGGAATTCCACAGGCGCCGGGATCACTAAACGTGACGGGGGCCATTGTGCGGGTGCACGGCTGCCGCGA
GCGACGGTTTCCGATCCTGAGGCAGCCGTGGATGAGGGAACGGGCAGACAAGATCAAGGCGATCGGGGTGGCGCCGTTTG
AGGAGGGTGGCAGTGGCAACATGATGGGCAGCAGCGGAGTGCTTGCAGCCGAGAAACTGTCGCTGCAGGTGATTCCAGCA
CAGCCACTGGTGGTGGTGCAGTCGACGACACTGGCGCAATCGTCGGCGATGATCCTGGAAGGCGAGCGGCAGGCGTTCTC
GGTGACGCTGCAGAATCTGTCTCTGACGACGGCAGTGGACTTTCTGATCTTCTCGTTCCAAGACTCGACACAGGCGACGA
TGCAGGCGGCGCTGGAGAGCCGGGACGCGTCGCCAGCCGAGCTGTACGAATACGAGCTGATGCTGGCGAAGCGACCGGCG
CTGCGGCTGCGAGGACGAAAGGGAGGAGTGGATGAAAAAACAAGCCAAAACCGGTACATCGGTCCCGGCGAGACGGCGAC
GTTTGACTTTGAGCTCCTGGGCAAGCCAGGGCTGACAGACGGGACGATCCAGATGGACTATGCATACCTAGGCGTGACAG
CCGAGGGGGTGGCAGCAGACGTGGTGGCAGGTGGGCAGTTCCACACGCGACAAGTGTCGCTGCATCTGACAGTGACGGTG
AACGCGAGCGTCGAGGTGGTGCGGATGGACGTGTTGCCGCTGCACGGGCAGATACCGGGGCCACTGTGGGAGCGATGTGG
AGGGGAGAGGCGGAAGCCCGATCCTGACAGCTTCTGTCTGCTTCTGATGGATCTGCGCAACGCATGGCCGAGTGACATGC
GGGTGCGGTTGTGGACGGGTGGCAGCAGCGGTGGCGACGGGTCGGACGCGGATGCGACGGCGATCGAGCACATTTTACCG
GGCAACACGTGCCGGGTATTGGTGCCCATGCGACGGATCTACCTGGAAGATCCGCACGCGTCGATCCCGGCACTCAACCC
AGCGCGACAGCGGCAGTTTGTGGTCAGCACGAGCAAGATCTCGCCAGACATGGAGCGGGCGACCCGGGAGACGTTCTGGT
ACCGGGAGCGAATGCTGGACCTGCTGCGCGGCGAGTGGACGACTGGGGGGGAAGAGGGCGACTGGGCGAGCGGACACGGA
TTCGGACGGCCAGCCGTGCGGAAAGGGGCGATTGAGCTGCGAAGCATTCGGCTAACGATGCGGATGATTGAGGCGGTCAA
GGTGGAGGAGGTAGGGATTGAAATATGGATGGAGGGGGGTGGGAAAGGGGAGTGGGAGAAGGACGAAGGGAAAGAGGACG
AGGAGAAGGAGGGCGAAGAGAAGGAGGACGAAGAGAAGGAGGACGAAGAGAAGGAGGACGAGGAGAAGGAGGACGAGGAG
AAGGAGGATGAGGAAGAGAAGGACAAGGAAGAAAAGGACGAGGAGAAAAGGAACCCAATCGTTCAGGTCGACGACTTCAT
GCAACTGCGGGTACGCATCACAAACCGCACAGCACGGCCAATCCACCCGCTGCTGCGACTGATGCCATCGCTATGCCATC
GGCCACACAACGTGGCCCTGGACTTTACGCGCAAGTTTGCCTGGAATGGAACGCTGCAGCAGGGCCTGGCACTGCTGGGC
CCGCGCGCATCGACGATCGTGCGCATCGGTGCCACGGCCCTGTGTCGCGGCGAGTTCGAGGTCACCGCGTCCGTCGAGGA
GACCCGGCTGTGGGTGCCGGCACGCGGCGAGGAAGAAGAGGCCGAAGCTCGACGAGCAGATCGTGCAGATCAGGCGGCTG
GCCGGCCACGCTCCAACACCGAGACCCTGTTGATGGACTCGATGCTGGGAGCCAAGGAACGGCGGATCTGGCACTCGCGG
GCGCCGTGTCATTTTGTGGTGACAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62