GenePrediction:GLEAN_2747 Details

Name: GLEAN_2747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3003879..3004881 (+ strand)
Length: 1003
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3003879..3003916 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_140:3004000..3004111 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_140:3004180..3004881 (+ strand)
Length: 702
>GLEAN_2747 class=GenePrediction position=GCSC_140:3003879..3004881 (+ strand)
ATGTTCAGAAACAACTATGACAACGACTCTGTCACATTGTGCGTGAGGCCACTGCGGGCCTGCTTTACCCTAGCACCACT
ACTGCCGTCTGGGCGAGACCGGCTGCTAACCCGTCTCACAGCTCGCCCCAGGGCCGGATATTCCAGGTTGAGTATGCTGC
CGAGGCCGTGAAGCAGGGCTCCGTCGTTGTGGGCATTGCCAGCAAGACGCATGCCGTGCTCGTGGCCGTCAAGGTGGGCT
TTCCCTTTTCCTTCTCGGGTTGCGTGCAGAGCCAGGCGCTGATGACGCCTTTTGTTTCCAGCGGAATGCCGAGGAGCTCT
CGTCGTACCAGAAGAAGCTCTTCCCGGTGGACGAGCACGCGGGCATCGCGATTGCGGGTCTCACGTCGGACGCGCGCGTG
CTGTCCAACTTTATGAAGCAGCAGTGCCTAGGCCACCGGCTGACGTACGGTCGCTCGATGCCGGTCCGGCTGCTCGTCGA
CATGATTGGCGAGAAGGCCCAGGTGAACACGCAGCACTACGGCCGCCGGCCGTATGGCGTCGGTCTGCTCGTCGCCGGCG
TCGACGATCGTGGTCCCCACCTGTTTGAGTTCCAGCCGAGCGGCATGACCGACGAGATGACCGCCTTTGCCATCGGCGCC
CGCTCCCAGATGGCCCGCACCTACCTGGAGAAGCACCTGGACGGCTTTGCCGCCTGCGACCGCGAGGGCCTCGTCCGCCA
CGGCCTGCGCGCCCTCAAGGAGAGCCTCGTCCAGGACCGCGAGCTGACCGTCGACAACACCAGCATCGGCATCGTCGGCA
TCGTGCCCGCCGCCCAGTCCGCTACCGGCAAGCGCCAGGTCGAGCCCTTTACCATCTACGACGGCCAGGATGTCAAGGCC
TGGATAGAAGCCGTCGCGGACGATAAGGAGGCCGGCGCCGACGATGACGACAATACCGCTGCGCCAGACACTACAGCAGA
CGCAGGGGCCGCTGCGCCAGGCGACATGGAGGTCGACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62