GenePrediction:GLEAN_2748 Details

Name: GLEAN_2748
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3007396..3009465 (+ strand)
Length: 2070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3007396..3007443 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:3007495..3009465 (+ strand)
Length: 1971
>GLEAN_2748 class=GenePrediction position=GCSC_140:3007396..3009465 (+ strand)
ATGCCGCAAGACAATGCGCCTGCGGGCAATGCCCGAGGGGAGCAAGGCGTAGGTGCCTCATTTTGCTGCCATCCCCCGCT
ACACTAACTGACCGAGCAGTCCTCCATGACGACGCGGATCATCCAGATGGTGGCCATGTACGTCGGCATGCAGTTTGTCA
TGAAGCAGTTCATGCCTACGGCTCAGTCTTCTGTGCAGACGACCGATGCTAGCGGGAAGACGGTCCAGGTGCCAGCCGGC
ACGACCGTCATCCCGCCGTATCAGCTGCGGCCGGCCAGCCTGGACGAAGGCGCCGTGTACAACGCGGACCCCCAGCGCGT
GGCGCCGATCTGGCCCGATGACAGCAAGCTGGATATTATCATCACGGTATCGCATACGCCCCAGATCAAGCCGCTCGGCG
GCCGCGACGCCGACCCGGTTGTGCTCTCCGAGACCGGTTTTGGGCTCGGCAACTTCAGCGACAAGCGGGCCATCGACACG
GTCATCGACGTGCCGCCACAGGTGCAAAACAATGGGACGCTGTGGGGCCACTTCTTGATCGGCCTCCAGGGCAGCGTGCT
GGATCCCTACAACGCCGCCTTCGACCCCGGGGCGGCCTTTTACTTTTCCTTCCCGCTGACGCAGTACATTGCGCGGAAGA
AGCAGGTCAAGGTGCGCAACCTACTCGCGGGACCGGACACTGCCGACGCCGAGAAGGAGCTGGAGAACGAGCCGGAGACG
CCGTCGGGACCGATCATCGGCAGCTACTACCACGCCAACACGTCGCTCTCGTTTATCCCCAACGGCGGCGTAATGCAGTA
CCAGCAGCTGCCGCCGGTGGTGCAGCAGTTTGTGCATCTCGAGCTGACGGGGCAGCGTGACGGGTCCGGCCAGAACACGT
GGTACTACCCGGTGCTCTTTGTCAACACGTTCTGGCAGCTCAAGAGCCAGATGACGGTGCTCAACGAGACGGTCAAGACG
CTGCCGCTGCATCTGGACCTGGGCAATCTGGCGGACTGGAAGTTCAAGTTGATGTCGAGCATCGAGGCGAGCAGCCGGGA
GACGGCGCGGCAGTCGGCCTTTGGTAACCCGGCGCCGGGCGGTGGCGATGGCTCGGAGATCGACATGATCAAAGAGATTT
TGCTGGACACGAACCCGATCCTGCTGTGCGTGACTGTGGTGGTGTCGATTGTGCACACGCTGCTGGAAATGCTCGCCTTC
GGCTCGGACATTGCGCACTACCGCAAGAAGAAGGACAATGTCGGGATCTCGGTGCGGTCGATTTTGGCCAACGTGTTCAT
GCAGACGGTCATCTTCCTGTACCTGGTGGACAACTCGCAGAACACGTCCTGGGTGATCCTGGGCTCACAGGGCGTCGGCA
TCCTGATCGAGCTGTGGAAGGTGACGACGGTGGTGGACGTGCGGCTGCGCGACGCACCGGCCGGCTCGCTGATCCCGTGG
CGCCTCGCCTTTGAGGACAAGCACAAGCTGAGCGAGACGGAGGAGAAGACCAAGGAGTACGACGAGATCGCGTTCAAGTA
CATGTACGTGGCAGCGGTGCCGCTGCTGGTGGCCTACGCCATCTACTCGCTCGTCTATGACAGCCACAAGTCGTGGTACA
GCTACGTGATCGCGACTCTGGTCGGCTCTGTGTACGCGTACGGCTTCCTGATGATGGTCCCGTCGCTCTATATCAACTAC
CGACTCAAGAGTGTGGCCCACATGCCGGGTAAGGCCATGATGTACAAGTTTGTCAACACTTTTATCGACGACCTGTTTGC
CTTTACCATCAAGATGCCCTTTCTGCATCGTCTGGCCACTTTCCGCGACGACATCATCTTCTTCGTCTATATCTACCAGC
GCTGGGCCTACCGGACCGACTACACACGGGTCAACGAGTTTGGCCAGGGTGGCGACGACGACGAGACGGACGAGCCAACT
GTGAAGGTAGTGGAGGGTGTGAAGGGAAATGGCGTGGAGGAGAAGGGCGAGGACGTGGCGGATGTAAAGGACAAGGCCAA
GAAGGCCGCAACCGGCAAGGCTTCAGGCTCTGACGCAAAGGCTGGAGGCGCGAAAAAGCGGAAACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62