GenePrediction:GLEAN_2749 Details

Name: GLEAN_2749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3010200..3015983 (+ strand)
Length: 5784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3010200..3014688 (+ strand)
Length: 4489
Type: CDS
Source: GLEAN
Position: GCSC_140:3015097..3015733 (+ strand)
Length: 637
Type: CDS
Source: GLEAN
Position: GCSC_140:3015794..3015983 (+ strand)
Length: 190
>GLEAN_2749 class=GenePrediction position=GCSC_140:3010200..3015983 (+ strand)
ATGGACTATACACGGCTGCGAGCCGCCGCCCTCCGTGACGGCGAGGCCGAGGAGGCGGTGACGGTCGACACGCGGGCTCT
GATCGACAAGGTCTTGGCCCGCTACTCGGGCGAATGGACGACGCTCCGGGAGCTGATCCAAAATGCGGCGGACGCGCAGG
CCACGACGGTCAAGATCAAGTGGGAGACGCTGCCATCGACGACGGTGCCGCTGCCGACGGTGCCGCAGCCAACAGCCACA
GATGCGGCGGATGGCGGCGACAGAGCCTCGAGTGACCTCCTCCGCCACACGATCCTGCACCACACGCTGCGACGGCTGTT
GGTCGAGAATGACGGGCAGGCGTTTGCGGCGACAGACTGGGCGCGGCTCAAGCGTATTGCTGAGGGCAACCCGGACGAGA
CCAAGATCGGGGCCTTTGGCGTCGGGTTCTACAGCGTCTTTGCCGACTGCGAGGAGCCTTTTGTCAGCTCGGGCAGCGAG
GCCATGGCCTTTTACTGGAAGGGCAACGCGCTGTTCACGCGCAAGCTGGTCGTGCCGGCCGACCAGCGCAGCCCGACGGG
GGCGACGACGTTTGTGCTCGACTACCGCAACGCCACAACGGCCCTGCCAAACCTGCTGTCGGTCAGCCAGTTCCTGGCAT
CCAGCCTGACGTTTGTGGCCCTGCAGCGCATCGAGTTCTGGATCGACGACTGGAAGCTGCTCGACCTGCACAAGACGCTC
TCGCCGAGCACGGTCGTGCCCATTCCACGTGACCTCAGCACACGCACCAAGGACGGGCTCATGACCGTGGCCGCGGTCGA
GTGGTCCAGCGCCCAGATCGACGCCGTCTACATGAACGCCGTCGGCTGGAAGCCGCCCGCGTCAGCAGTCAACAGCGCGT
CGGGGTCGTCGGGCGGCAGTAGCTCGGCCGCGGCCTCGGGCAAGACCACCGACTCGTACGGGCTCTCGGCCGCGGATATG
CCGTCGCTGCGCAGTTTCTTCTCGCGGCTGACCAGCTCGGCAACAGCGTCGGCGACGGCCCTGGCCAGCCAGCGCAGCAA
AGCAGCCCGCGAGGAGAAGGCGGCCCAGGATGCCCTGCAGCAGAACCTTACCGGGCTCGATCGGGCGTCCATCTTCCTCC
GGGTCACCTCGGCCAAGGTGCAGACCAAGGTAGCAGCCAGCTTTGCGGCCGAGCTAGAGCGCGCGACCAAGAAGCCACCG
CCCAAGATGACCAGCATGGCCATCCTCACGTCATCGTACGAGGACGTGCTCACGTCCGGCGCGAAGACGGTGGCGACCAC
AACCGGGGCCGACGTGTTTGCCTCGGTGCTGCCCAGCAAAAAGCCCGGCGGGCGGATCTTTATCGGATTCCCAACGATGC
AGACGACAGGCGGTGGACTGCACGTGTCAGCGCCGTCGCTGATCCCGACAGTCGAGCGCGAGGCCATCGACCTTAACGCG
CGCTGGGTGCGCAACTGGAACATGGAGCTGCTGCGGGCGTCGGGTATCCTGACGCGACTGGCCTTTGTCAATGAGATGGC
CGTGCTGGACAGCAAGTTCCGGCAGCACCTCGAGAGCACCAACCGAGGCAGCAAGGGCAGCCGGTTGCCGACGCCGACGG
CCGAAGACGTGGCCCGGTTCGTGCCCGAGGCGCTGCACATTCTCAAGACCTACACGTTTGGCGATTCGACACCGAGTGCA
TACGTCGGGCAGATCATCGAGGAGGCCTTCTGGACGGCGTACAGGGTGCCGGCGATCGACGTGTTCTCGACGCGCGGCGT
GCTGTCGACGGCCAAGGTGCGGATGGGCGACGAGCGGATCAGCCGGTTTGTGGACGGGATCCCGGTCGTGGTGGCGGAGA
TGAAGGACAGTCCGTTTGTGCACAAGCTGCATGAGTTTGGCATCCTGCACGACATCACGATCGACGACGTGCGATCGGAG
CTGGAGTCGAAGCCGCTGGACCGGGAGAAGCTGACGCACTTTGTCAAGTGGCTGGCAGCATGTGCAGCATCTGGCGACCT
GGATCCGCCCAGCGTGCGGTCTCTGCTTCGAGCCGGCATCGCCAGCATCGCGGAGACGGAGGACGGAGGCGGTGGGGACG
ACAATCCGATCCAGTCGTACATTGTCGAGCTCGACACGATCCGCAACTTTCTGTCAGGCAACAAGATTCCGGCCAGCCTG
CCGTTGCCGCCGACGACGATTCCGTACTCGATCACGAGCACGATTCCGCACAGCCAGCTGCAAGCGCTGGGCTGGACGCC
GCTGGATCTGGTGCCGTGGCTGGAGTACCTAATGGGCGCGCGGGCGCGGCTGGGCGAGAAGCGGGACATGACCAAGTCGG
CCACATTTGCGGCGCAGGTGCTGATGGTACTGTCGAAGAACTGGGACAACGTATCGGCAGCGCAGCGGCCGGTAGTGTTG
GCGATGCTGGAGGCGCAGACGACGATGCCGACGAAGATGGGCATGCGACGGCCACCGGACGCCTTCTTCCCGTCGGTCAA
GCTGTTTGATGACCTGCCGACGCTGGCGCCGAGCTGCCACGGCCTCAAGGAGAAGTTTCTGGTGGCGCTGGGCGTGCGCA
AGACGATTGACCTGGACACGATCTTCACGCGACTGCTGAGTCAGCCGACAGCAGACTCGAAAAGTGGCGGTGGCAGCAAA
GGACCGGAGGTAGACAGCAAGAAATGGAGTCACGTGGAGCTGGCCAAGTATCTGGCATCAGTGCGGACAGACATTCCAGC
GCGAGACTTTGCCAGGCTACGGGACTCGGCCATCTGTCCGGCCGAGGCAGGTCCAGCAGGCAAGGAATGGACGGTGCCGA
GCACGAAGCTGTACCGAGCAGCAGAGTTGTTTGAGCCGTGTAGCGAGATCCGGGAGCTCGGGTTTGCGATCATGCAATGG
CCGGGCGTGCCGGGCTCATACCGACGCAACTCGCCGGAAGGCGGGCTCCTGTCCAGCCTGGGGCTCCGGATCTGTCCGTC
GGTGCCGGAACTGGTGGCCAAGATGGCGTCTCCCGACCGCAACCTGCGCGACAAAGCGCGTGCCTACTATATTGCCAACC
ACCAGACGAACGGATATCAGGCGTTTAACATCTCGCTGACCGACAAGGCGATCCTGCCGGTGGCGAGTGACGGCAGCAGC
GGCAGCAGCAGCAACGAGAAGCAGCTGGAACAGCTCGCACGGCCGATGGGATGCTACACCAACCCAGATGCGGCAATTCT
CGGCTTTCCGATCCTGCGGGCAGACCTACTGCCGCACGCGGCTAAATTCGGCGTGCCGCGTGACCCTCCCATAAACAGCT
GTGTGAAACGGCTGCTGACGAAGCCGCCGCAGAGCCATAAAGAGGCGGTGGTGGTGTTTGGGTATTTCTCGTCACGGCTG
GCGGACATCCGAGGCGACGCGCTCCGACAGCTACAGCAGGCGCGCTTTGTGCCGGTGACCAAGCGCAGCGGGTGGACAGA
CAAGGGTCAGCGGATGTCTATGGCAACGGCAGCAGCGACAGCAAAAATGGAACACGTCAAGCCCGAGGCCTGCTATCTCG
GCGTGTCGTCGACGTACGGCGACATCTTTGACTTTGTGGACTTTGGACGCAGCGCGAACGCCTTTCTGTTCCAGTGCGGG
TCAAAGATGGAGCCGACAAAGGTAGAGCTGGCCCGACAGGCCTGCAAGGAGCCGGCACGGCTGCTCAGCACGCTGCAGAC
ACCAGAACGGTACCTCAACCTGCTGCGGTCGCTGGCGGAAGACCTGCCGCGACTGAAGGAGGACCGGGAGCTGTTTGGGC
TGATGCAGACGGCGCCATTCCTTCTGGCATCACGCGAGGCCGTTCCGACGACGGGAGCAACAGAAACAGAAGAGGAGACG
CCAGTGCGGCAGTTCCAGCTGGCGGCAGCGGGCCAGATTGCGGTGTTGGACGACTACATCAGCTACCGGCTATTCAAGGA
CAAGCTGATGTGTGCGCCGGAAGAGGACGTGTTGGAGACGTTTTACCTGGCACTGGGAGCGCAGGTGCTGAGCAGCATCG
TGCAGGAGGAGATCCAGATTGGGCGACACAGCAGCGACCAGACGCAGGCTGCGCTGCTGCGCAAATACGTGCTAGAGCGG
TCCAAGATCTTTTTGCACGAGTACCAAAAGTACCGGCGTGACGTGATCCGACACGACCACCGCTGGCTGGAGAAGCACCT
GCGGGTAGAGATTGTGCAGAGCGTGGCGCTGCGGCGATCGCTGCGCGGTGGCGGCGGCACGGAGACGCACACGGAGAAGC
GGTCGGCGGCGAGTGCGCGCCAGACGGGCGGTCATGTGCTGTACATCTCGGCACAGGGACCCGTGGACATGTACCAGGTC
GGCCAGGCGGTGTGTCAGGTGGTGCTGAACCGGCCGAGCCAGCAGGCGTACTTTTTCTTTGAGCCGTTCCTGAAGCTGGA
CCTGCTGGACTTGCGGGCTCGCGGCTACAATGTTGACCGGATCCTGCGCGAGAAGGCGGCCGAGGCACGCATGGCCGAGG
AGGAGCGACGTCGGGCTTTGGAAGCGGAGCAGGAGAGAAGACGAGAGGAGAGGGAAGAGAGAGGGAGAGAAGAGAGGGGG
AGAGAGGAGAGGGGAAGAGAAGGAGGGAGAGAAGAAAGAGGGAGAAACGAAAAGGGACGGGGACAATACTCGGAAAAGGA
CCGGCTGAAACAGCGAGACCAACAGCAGGTAGAAGCAGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCATGACGAGGA
CAAGAGCACATACACCCGAGCCACAGATGCCGGGAGCATTTGGCGACGAGGGATCGCCGGAAGAACAGCGTTACCAACAG
GAACAGCAGCAGCAGCAGCAGCTACAACAACAGGGCAGACGAAACAGAGGTCTCTTCTCGACCATTACCCGTCGACTGGG
ACTGGACCAAAGCCCAGAGGACGACGAGATGGACCGACAGCCAGACGCCGGATCCATGGACGGCAACAAAGGCAAAGGCC
GGGTGACGACGACCGAGGGCGACGGCAACGGCCAGGAGGCCTCGCCGGAAGCCGTGCAGCAGGACATGCGCAACGCGATC
CGGTCGGGACGGCCGTACGGGTCATCGACGTTGTTCCAGCCGCCGAGCGAACCGACAGTGCGCCAACAAGCGACATACTG
TGACAGCAATCATGCGCACGACCTGGAACACATCGGGCAGGCACCCGGCGGCACGCCCATCTACCTGTCACGTGGCACGA
CCTCTTCCGTGACGGGCTTTCTAGCCGAGCGCCAACCGGCCATTGCAGCTTTTGAGCGGCTGCTGCGCGACGTTGCCGTC
GTCTACGGCCTGGCCAGCACCGTCCTGCACATCTACCATGATGTCGTCGGACCGACGATTGCCTTTAACAGCGGTGGCAG
CATCTTCTGCAACCTGCGCTTCTTCGAGCAGCTGCACGCAGCCGGCATCCTGTCGACGGCAGCAACAGCAGTCCAGGCTC
GCGTCGATGCTACCGTCTGGTGGTGGGTCGTGCTGGCTCACGAGCTGGCCCACAACCTGGAGCCCATTCACAATGCCCGC
CACAGCTTCTACACGTGAGTTTCACAGCCGTCTACAGAGTCCTCCGTCTTGGTCCATGCTGACAACCAACCCAGTGAATC
GTTTGTCCAGCAGTACTTCCACGGTATGACCATGCACACGGCTGCGCTCTCGGCCGGCCTAGCCGTCCAACCAGCTGCAC
TGCCACAGCCGCTCGTCCAGCAGCCCGACGTCGCCCTGCCACCACCGCCTTCGTATCACCAGGCGATGCAGACACGTGGA
CAGGGCCGGAGCCTGCTTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62