GenePrediction:GLEAN_2751 Details

Name: GLEAN_2751
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3028869..3029651 (+ strand)
Length: 783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3028869..3029021 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:3029089..3029277 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_140:3029332..3029598 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_140:3029610..3029651 (+ strand)
Length: 42
>GLEAN_2751 class=GenePrediction position=GCSC_140:3028869..3029651 (+ strand)
ATGAGGCTTTCGAATGTCATTGCAGGCGCTACCGCCTGGTTCGCGACCGACGTCGCGGCGACAGCGCTGACCTACAAGGT
CACGGCGAACGAGAAGGCCTGCTTCTTCGCAGATGCTACTAACAAGGGCGAAAAGATCGCCTTCTACTTTGCGGTAAGTG
CCGCGTGTAGCTCCCTTGCTGCGGTTTACGTCCGGATGCTGACTGCGCCTACGTATCTAGGTCCAATCTGGTGGTTCTTT
CGACATCAACTATGAAGTGACGGGCCCTGCAGGTGGTGTCATTATCGAAGGCGAGAACGAGCGACAGGGCGACTTTGTCT
TCACAGCCAACGAGCCCGGCGAGCACAAGTTTTGCTTCAACAACGAGATGAGCACATACACGGACAAATACGTTGATTTT
GAGATTTCCGTACGTGCCTTGCGTCGGTCCTCTTCCGTCCCCAGGCCACCGCTAACAGTACAGGTGGAAAACGAAGCTCG
CGTCCAGCTGCCGTCTAAGCAGGGCAGCTCAGACGAACAGACCGGCAAGATCGCCGAGTCTGTGTTCAAACTGTCAGGCC
AGCTCACGACCATCACGCGCAACCAGAAGTACTTCCGCACGCGCGAGAACCGCAATTTCAGCACGGTCCGTAGCACCGAG
AAGCGAATTATCAATTTCAGTCTCATCCAGTGCGGCCTTGTCGTTTGTATGGGCGCATTGCAGGTGTTCGTTGTTCGCTT
CTTCTTCCAAGTATGTCACAGTGCCGCCTTCCCCCACTTAGCCCCAGCATCGCGACGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62