GenePrediction:GLEAN_2752 Details

Name: GLEAN_2752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3030229..3032318 (+ strand)
Length: 2090
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3030229..3030375 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_140:3030439..3030522 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:3030584..3031009 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_140:3031069..3031117 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_140:3031177..3031257 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:3031315..3032318 (+ strand)
Length: 1004
>GLEAN_2752 class=GenePrediction position=GCSC_140:3030229..3032318 (+ strand)
ATGTCTTCAATCGCGGCGTCACTGGCGCAGGCGCTACCGAAGCCCAAATACTCGGGCGAGGAAGAGGAGCTGCCTTCACG
AGCCGTGCCTCGTGGACCGCGTATCGTCAGCGCCAGCGAACTGGACGAGACACAAGTTGTTGTCAAGGTTTGCGCGTCTC
CGGCCGATGCTTCCTGTGATGTTGAGAGAGTAAAGCTGACCTCTTTGCAGAGGGCCGGGCCGCCAGCATACGGGAGGCGA
GCAGGATGGAGGCCGCGCGAGGCAGAGGATTTTGGGGATGGAGGTGCCTTTCCGGTCAGTACGCGATGGAGGACACAAAT
GACTCGAGGTGGCTAACATTTCTGCCGGGCTTTAGGAGATTCTCTTTGCACAATACCCGCTGGGCATGGGTCGGACGGAG
AAGACGAAGAACAACGCACTCGCCGTGCAGGTGGACGGGGACGGCAAAATCAAATACGACGCGATCGCACGGCAGGGCCA
CACAGAAGGACGGGTGATCCACACGTCCTTTAAGGACCTGATTCCGCTGCGGCAGCGAGCGGAGGCCGGCGACATCAATC
TCGAGCGGCCAAGCCAGGAGGAGGTCGAGGCGACGGCAGAGCGGACGAGGAACGCGCTGGCAAAGCTCGTGAACGGCGCG
GTGGCGGCACAGAAACCCAAGACGCTGGCAGCTATGGGGGAGCGAAAAGAGGCCACGTATGTGCGATACACGCCAGCATC
GCAAATGGGCGACACCTCACAGAAGGCCGATCGGGTGATGAAGATTGTTGAGCGGCAACGGGTATGTTTTGCTTTCGAAG
GGAACCGCCTCACACGCACATCTGCTAACTCTGTTATCAGGATCCTATGGAGCCCCCCAAGTTCAAGCACAAAAAGATTC
CGCGCGGTCGTAAGTCTTCAGTCAGATGCGTCTACCAATGTATCGTTGCTAATTGTCCGTCTCAACAGCCCCGAGTCCTC
CACCGCCGGTGATGCACAGTCCGCCTCGCAAATTAACGGCGGCCGATCAGGAAGCCTGGAAGATTCCACGTGAGTCCGAG
GACGTCCGCATGCCTCCTTGAGACAAATCTAATGTGGTTGTTGCAGCACCCATTTCCAACTGGAAGAACCCCAAGGGATT
CACCGTTCCGCTGGACAAGCGGTTAGCGGCAGCCGGTAAGGGCTTGGAAGATGTCACGATCAACGACAAATTTGCACAGT
TTTCGGAGGCGTTGTTTGTGGCAGACCGACACGCGCGTGAGGAAGTGCGGCAGCGGGCACTGATGCAGCAGCGGCTGGCA
GAGAAGGAGAAGCTGCAGAAAGAAGAGCAGTTGCGGCAGCAGGCGCAGCTGGCACGAGAGGAGCGGGCAAAGGCGATGGC
ACCACGGCGAAACGGCGGTGGACGAAGGCGATCGCGGTCACGGTCGGGCAGCTACAGCCGGTCCGAGTCAGACTCGAGAT
CTGGATCAGATTCCGGCACAGACAGCGAGGAAGATGCGGTGCGCGAGCGTGAAGAGGCACGGCAGGAACGGCGACGCGAC
GAAGAGCGGAAGCTGCGGCAGTCTCGGATGGGTGCTGAGCGACGGATGCAGGTGTTAGCACGGGAGCAGAACCGGGACAT
ATCGGAGAAGGTGGCCCTAGGACTGGCGAAGCCGACGGCGTCCAAGGAGGGCATGTATGACTCGCGGCTCTTCAACCAGA
CGAGCGGATTCGACAGCGGCATCAACGAGGACAACCCATACGACAAGCCGCTGTTTGCGGCGCAGGACGCCATCAGCAGC
ATCTACCGGGTGCGGACGCAGGCGGGCGACGAGGACGACGAGGACGCGGCGGCGGGCGATGCGGAGATGGCCAAGATCCA
AAAGACGAGCCGTTTTGGCGAGGCACTGGGCCGCGGCACATTCAAGGGGGCGCGCGAGGTGGAAGCGCGTGAGGGCCCGG
TACAGTTCGAGAAGGAGGTCGCTGCACCGAGCGGAGCGGATCCGTTTAATGTCGACAAATTCCTGTCAGAGGTGGAGCAG
AGCTCGGCCGGAAAGCGTGGTTACGGACTGCAAGAGGAGGGTGGATCACGGCAGTCGAAGCGGGCTCGTGTGGACGAGGA
CGAAGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62