GenePrediction:GLEAN_2753 Details

Name: GLEAN_2753
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3034668..3035969 (+ strand)
Length: 1302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3034668..3034863 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:3034917..3035017 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:3035078..3035277 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_140:3035351..3035969 (+ strand)
Length: 619
>GLEAN_2753 class=GenePrediction position=GCSC_140:3034668..3035969 (+ strand)
ATGGACGCCTACAGAGGCTACAGTGCGCCGTGGTGGGATGTACGATTCTGGTCGAACAAGATATGGGCCGCGCTGGTCGG
AGGCCTTGTCGTGATCATTGTCATTGTCGTCCCGGTCGCCGTGGTCGAATCTCGCAAACACAGCAAGTCGGCCTACCCAA
CGTACAGCAAGATCAACTACACCCTCTCAGACACATGTAAGCAGTCGCTACCACCTTTCTCTCGTCGACGTCACTGCTGA
CACGACAAGACTCGGACGAGAACTTTTTTGACAAGTTCGACTATTTCAGCGGATACGATCCTGCCAATGGCTTTGTCCAT
TATGTGCCTCAGGGTACGGCCGAAAGCCTGGTACGTGAATTCCAGATGCCGCCGTACAGCCACACAGACCTGACTTTCCC
CCCTATCTAGAACCTCACGAGCGCCTCGACGTCTGCGGCTGTCGTCCGTGTCGACACGTCTGTCGGGAACACGTCGTCTC
CGGATGCCCCGACTGGCCGCTTCTCCGTCCGGCTCACGTCCAAGACCCAGTACGACAGCGGGCTCTTCATCTTTGATATC
AAGCACACACCCTATGGCTGTGGCACGTGGCCAGCATTGTGGCTGTCCGAGTATGTACCTTTTTGGTCTTTTTCTTCTTT
CCTTCTTCCCTTCTTCCAATCTTCCCTCCGCTGACACGACAAGCCCAAACAACTGGCCCGACAACGGCGAGATCGACATC
ATGGAGGCTGTCAACCAGGGCACGTCCGGCAACCAGGTTACGCTGCACACCACCGACGACTGCACGATGAAGTCGGTTGA
GCGCATCATGTCCGGCACCGTCGACCAGGCCGACTGCCACAACACGACCAACGAAAACGCCGGCTGCGGCGTCACCGGCA
AGAACTCCACGTACGGCCCGTCGTTTAACGACGCTGGCGGCGGCATCATGGCTGTCGAGTGGCGCGATGCCGGTATCCGC
GTATGGCAGTTTGACTCTGATGCTGTGCCCTCGGACATCAGCAACGACGCGCCCGACCCGAGCACGTGGGGGACTGCTCT
GGCCGACTTCCCCGACACCAAGTGCAGCATCAGCAGCCACTTCCGGAACGCGAGCATCATCGCCAACATCGACCTGTGTG
GAGCGCTGGGTGAGGCCAAGTACGCCTCGTCAGGCTGCCCGAACAACTGTGTTGGTAGCCACACGTGTGTCGGTGGCTAC
ACGCCCACAAACTGCACCGATTACGTGGCCAACTATCCGAATGCGTTCAAGGATGCATACTGGGAGTTTGGCACCTTTAA
GGTCTTCCAGGCGAGCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62