GenePrediction:GLEAN_2754 Details

Name: GLEAN_2754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3043248..3044828 (+ strand)
Length: 1581
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3043248..3043411 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_140:3043557..3043959 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_140:3044010..3044828 (+ strand)
Length: 819
>GLEAN_2754 class=GenePrediction position=GCSC_140:3043248..3044828 (+ strand)
ATGGCCAGTCCGTCAGGGCGGTTGCGCATCGCCTGCTGTCGTCCTGCTGCTGGCAGTCGCTTCTTCTGGCTTTCGGCTCT
GCCTCGAAGGTCTCTGTCGACTTCTCCGGCAGCCTCTTACTCTCCTGACATTTCGAAATGGAGGCCCATCTCTGTTCTTG
ACGAGTAGGTTCCTCTTTTTTCCCTCTCTCCTCTCCTCATCTCTCTTCTTCCTCTTTCTCCTCTCCTCCTCTCCTTCCTC
TCTCTCCTCTCCTCCTCTCCTTCCTCTCTCTCCTCCCCTCTCTCCTCTCCCCACTGACTCACATCGCAGTTGGGTCGCCA
AGGAGGCCCGTCCCATCAGCCTCCGTCAGCTCATGGTCTTTGGCCGGTCGTTGACCGAGGCCCGGCTGATCAGCTCGGGC
AACTATGTCCGTACCGAGCTGCCGATCCGGCTGGCCCACCGCATCCGCGACATCCAACAGCTGCCCTATGCCGTCGTGTC
GAACCCACACATCAGCGCCGTCTACGAGCTGTACTACGACGCCTTTGACCGCCTGCGCCGCCTCAAGGAGATCCGCTCCC
TCGACGACAACGACGCGCTCTGCACGGCCATCGGCCACACCCTGCAGGCCCACCTGCCCGTCATCCCCAAGCTGGCCATG
GGCATCCTCGAGTCGAGCGGCCTGATGGGGCCCGGCGACCTCGACAAGTTTATGAACACCATCCTGCGATCGGTGAGCTG
TCTGCGTGTCTTTGTGTCTGCCTCCCGCTCTAACACCCAGAGCGCATCTCCCGCCGCGTCATCGCCGAGCAGCACCTCGC
CCTCACCGAGACCTTTGGCGCCTCCTGGTACTCGCCCGGCGCGCCGCTGCCCGAGAATCACGACTTTATCGGCGAGGTCT
TCCTCAAGTGCGCCGCCCGCGACGTCATCGAACGCTGTGCCAACGCCGTCTGCGCGCTCGCCCGCAGCGCCTACGGCCCC
CATGTCACGCTGCCGCGCGTCCAGATCGCCGGCCACCTCGACACCACCTTCCCCTACATCCTCAGCCACATCGAGTACAT
TGTGGGCGAGCTGCTGCGCAACGCCGTCCAGGCCGTCGTCGAGAAGCAGCTCCGCCTCGGCACCGGCACCCCGCCCCCCA
TCGAGGTCACCATCTGTGAGGCCCAGCAGCACATCATCATCCGCGTCTCCGACCAGGGTGGCGGCGTGTCCCAGGACATG
CTCCCGTACCTCTGGTCCTTTAGCAAGGGCGAGCACTCGCAGCGCCTGCTGGAGAACCTGCAAAAGGTGCCCCGGATGAG
CGCCACGTTGCAGGAGCTACAGACAGACGATTCGCACCAGCCGCACAAGCACGGCCATCGCCACAAACACGTCAATCCCG
ACTCGGACCATGGCAGCTCCCTCTCCACCCTCTCTCAGCGCCCTCCAAACCTGCGTCTCGGCATGGGGCTGCCCTTGAGT
CGCGTCTACGCCGAATACTGGGCTGGCAGCCTCGAGCTTCACAGTCTCGAGGGATATGGCGTCGACGTCTTCCTTCAGAT
CTCCAAGTTGGGAAACAAGAATGAGCAGCTGACACGGCGGGCAAGCATGGATGCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62