GenePrediction:GLEAN_2755 Details

Name: GLEAN_2755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3047417..3050257 (+ strand)
Length: 2841
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3047417..3047434 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:3047499..3047611 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:3047662..3050257 (+ strand)
Length: 2596
>GLEAN_2755 class=GenePrediction position=GCSC_140:3047417..3050257 (+ strand)
ATGAAGACGGATTTCAAGGTGAGCATGGGGCGTCTGTCCGCGGTGGTCGAGCATGCGGTGCTGACGTGATTCGCGCCCAC
AGTTCTCCAACCTGCTTGGGACCGTCTACTGCCAGGGCAACTTGCTATTTAGCCCAGACGGCACCCAGCTCTACTCGCCC
GTAGGCAATCGGGTGACGGTGTTCAACCTTGTCGAGTAAGCGCAACCAAGCCAGCCCCCAAGACAGAGTGCTGACCCGGT
CGCAGCAACAAGTCCTACACGCTCCCGTTCGCCCACCGCAAGAACATTGCACGAATCGGCCTCACGCCCAAAGGCAACCT
CCTCCTCTCGATCGACGAAGATGGACAGGCGATCTTGACGAACCTGCCGCGGCGCATCGCGCTGTACCACTTTTCCTTCC
GCACGTCGGCCTCGGCGCTCGCCTTCTCGCCCTCCGGGCGCTTCTTTGCCGTCGGCCTCGGCCGCAAGACTGAAGTGTGG
CACGTGCCATCGACGCCGGATTCCAGTGCCGATGGCGGGCTCGAATTTGCCCCATTTGTGCTCTACCGCACGTACGTGGG
GCACTTTGACACGGTGCAGCACATCGAGTGGTCGAGCGACTCGCGCTTCTTCCTCACAGCGTCCAAGGATCTGACGGCAC
GGATATGGAGTCTCGAGCGGGAAGAGGGCTTCACCAACACGGCGCTGCCCGGCCACAAGCAGGCCGTTGTCGGCGCCTGG
TTCTCCAAGGACCAGGAGACCATCTTCACGGCCAGCAAAGACGGCGCGCTGTTCGAGTGGAAGTACCGGCGGCCGCTGGA
CATCGAGGCCGACGCCGACGACGATGACGAGCAGGCCGACGACGAGGCTGACTACCGCTGGCGGATCGTGAAGCGCAACT
ACTTTATGCAGAACAACACGAGCCTGCGGTGTGCGGCGTACCATGCGGCGTCAAACCTGCTCGTGGCCGGCTTCTCGAAC
GGGCTCTTCTGCCTGTACGAGATGCCCGACTTCAACATGATCCACACACTGAGCATCTCGCAGAACGACATTGACTTTGT
GACGATCAACACGTCGGGCGAGTGGCTGGCTTTTGGCGCGTCCAAGCTGGGCCAGCTGCTCGTGTGGGAGTGGCAGTCCG
AGTCGTACATCCTGAAGCAGCAGGGCCACTTCGACTCCACCAACGCGCTGGTGTACTCGCCCGACGGCCAGCGTGTCGTC
ACCACGGCCGACGATGGCCGCATCAAGGTGTGGGACGTCGAGTCGGGCTTCTGCATCGTCACCTTTACCGAGCACACGAG
CGGTGTGACGGCCTGCGAGTTTGCCCGGAAGGGCAACGTGCTCTTCACCTCCAGCCTCGACGGCTCCGTCCGGGCCTGGG
ATCTGATTCGCTTCCGCAACTTCCGCACCTTTACCGCGCCCACTCGCCTGTCCTTCTCGTGCATGGCCGTCGACCCAAGC
GGTGAGGTCGTCGCGGCTGGCTCCATCGACTCGTTCGACATCCACATCTGGTCTGTCCAGACGGGCCAGCTGCTGGACCA
GCTGTCCGGCCACGAGGGCCCCGTGTCTTCGCTGGCCTTTGCGCCCGATGGCAGCGGCCTCGTGAGCGGCAGTTGGGATC
GTACTGCCCGCATCTGGTCCGTCTTTGCTCGCACCCAGACGAGTGAGCCGCTGCAGCTGCAGGCCGACGTTGTTGACGTT
GCCATCCGCCCCGACTCGCAGCAGCTCGCTATCGCCACCCTCGACGGTCAGCTGACCTTTTGGTCACTCTCCGAGGCCAC
CCAGGTGCTCGGCCTCGACGGCCGGCGTGACGTCTCGGGCGGCCGCAAGGCTTCCGACCGCCGCACTGCTGCCAACGTCT
CTGGCACCAAGAGCTTCTCCAGCATCCGCTACAGCACTGACGGTACCTGTCTGCTGGCTGCTGGCCGCAGCAAGTACATC
TGCCTCTATGCCGTCGCCACCGGTGTGCTGCTTAAAAAGTTCACCGTCAGCGTCAACCTCTCGCTCTCCGGCACCCAGGA
GTTCCTCAACAGCCGTCTGCTGACCGAGGCCGGTCCGCTTGACGATTTGGACGATGTCGGCGAGGCTTCGGATCGCGAGG
ATCGTCGCGACCGCTCGCTGCCCGGCTCCAAGCGTGGCGGCGACCCGTCTGCCCGCCGGCGCAAACCCGAGGTCCGAGTC
TCCGGTGTGGCCTTCTCGCCCACCGGTATGGCTTTTTGTGCCGCCTCCACCGAGGGCTTGCTCGTCTACAGCCTCGATGC
TGTCCTGCCTTTTGATCCCTTCGACCTCAGCATGGAGATTACCCCGGCTGCCACGCTCGCTGTCTTGCGCAACGACCGCG
ACTACCTCACCGCTCTCGTCATGGCCTTTCGCCTCAACGAGGCCAAGCTGATCGAGCACGTCTTCCTTGCCGTGCCGCAC
GAGCACATCTCGCTCGTCGTCGATCACGTGCCCACGGTCTACGTTCCGCGTCTGCTGCGCTTCGTCGCCGCCCAAACCGA
GCAGTCGCCGCACATCGAGTTCTGTCTGCTCTGGATCAAGGCTCTTGTCGACCGCCACGGCCCCTGGCTGACGGCCAATC
GCGGCAAGCTGGATGTCGAGCTTCGCGTCGTCGCCCGCGCCGTCGGCCGCATGCAGGACGAGATCCGACGCCTCGCAGAC
GAGAACGTCTACACCGTCGACTACCTCCTGCACCAGGCTGCCACTTCGTCGCAGAAACTGCCTCAGATCGAGTCGGGCGC
CCTGCTGCCCCTGGTGCCAGACGGCCAAAAGCAGTCTGAGGATCTCAATACCCTCGTACTGCCCGCCGTCCTCGGCGACG
ATGACGACGACGACGAGAGTGGCTGGATCGGAATGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62