GenePrediction:GLEAN_2757 Details

Name: GLEAN_2757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3055435..3058995 (+ strand)
Length: 3561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3055435..3055682 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_140:3055764..3058062 (+ strand)
Length: 2299
Type: CDS
Source: GLEAN
Position: GCSC_140:3058297..3058995 (+ strand)
Length: 699
>GLEAN_2757 class=GenePrediction position=GCSC_140:3055435..3058995 (+ strand)
ATGGCCAACCAGTTGGATAAGAACTCAACGGTGGTGCGAAAACAGCTAGAAAAGCATGCATTTCTGGGAGACGATGGCGA
AGAGTACGGCGCGAGCACGTTTGGGGAGTTTGGAGACTATTTTCGGAGAAAGAAGATCAAGCTCCAAAACGAAGACTATT
TGATGCGACAGGCTGTGCAGGGAAGGCCTCAAATCTTCAAGGGAGTAGTGGCCCATGTGGCCAGCTACACCCAACCGCCA
CCAGAAGAGTAAGTGGGGATTCTGGGCACATACAGAGTACTGGCTATGATACGATGGTGGACGCCGTGCATTCGCTAATA
TGAGTACAGGCTGCGTCGGCTTCTAGTCTTTCATGGTGCCGGCTACATCAAATATTTGGACTATAAGACTATGGTCACAC
ACATTATCGCTTCAACATTGCCACCAAAGAAGGCAGATGAATGGAGGAGATTGCGTGTGGTGCAACCGGCTTGGGTCGTC
GATTCCATAGCAGCCGGAAAGCTGTTGCCGTGGCAAAACTATCTATTGATCGGTGAAGGCCCCCGGCAAAAAAGGATCCA
ACTTAACGACGGCGGGTTGGTTGTACAGGATGGCCAGGCCAACCAGATGGCTGGATATCGAGTCCAGAGCAAGGCCAGCT
ACTATACAGACGATATACAGAAGCATTCTACGGTACTGCAGAACGACGAGGTCCACAAGATCCTTTCCTCTGTACACGAT
GCCCACAGCCCAGAAAAAGGACTTGATAACCTAGACGTGGACATGGACATGTTGCCAGATGGAGATGACTCGGGCGAGGA
GCAAGACGCCGAGGCCTCTACGGGCCTACTTCCAAGTCCGCAGAAGCCGGATGCCATGACATCAGAAGAGCACAATGCCT
GGCTGCTGTCTGACCCCAAGATACGGAAGTCGTCTACAGCGAATCCTGACTTTCTCAAGCAGTTCTATTCGGAGAGCCGT
CTTCACCACCTGTCAACATGGAGGGCAGAGCTGAAGTCCAAGATGCAGCGACTCGCAGCAGAAAAGGGGGCGACAGCACC
TGCCAAATCCAGCAAGCAGAAACCCGGAGCCCGCCGGTATATCATGCATGCTGATTTTGACAGCTTCTTCTGTGCTGTCT
CCTTGAAGAGTGCGCCGGAGTATGCCGGCAAATCTGTGGCAGTTGCTCACTCTTCGGGAAGCGCGTCTGAGATTGCTTCT
TGCAATTATACGGCGCGGCATTTTGGCGTCACGAATGGCATGTGGATGAAGAGAGCCTTGGAGCTTTGTCCAGACCTAAA
GGTTCTTCCGTATGATTTTCCTGCGTACGAGGAGGCGAGCCGCTTGTTCTACGAAGCCATCCTTCAGGTTGGCGGTGTTG
TGCAAAGCGTCAGTGTGGATGAAGCCCTCATGGACATTACGAGCATTGTGCTTACAGCCGCTGGATCGACTGGAGCCGGT
ACTGATGAGGGCAGTATCTGGCGGGAGCAAGAGATAGCCGACAGCATAGCGACAAAGCTACGACAACGCGTCCTAGAGAG
AGCCGGGTGTCCTATATCGGTCGGCATTGGTGGCAACATTTTGCTGGCCAAGGTAGCGCTGCGGCGAGCGAAGCCAGCCG
GACAGTTCCAGGTGCGACCTGGGGAAGTGTTGGAGATTTTGGGTGGTCTGAAAGTGGAGCAGCTGCCGGGGGTTGCGCAT
AGCATCAGAGGAAAGCTCGAAGAGATTGGCGTGAAGCTGGTCAGTGACCTCCGCGGCGTGTCGAGAGAGCGTTTGGTGGG
CTCGCTTGGCCCCAAGACGGGCGAACGGCTGTGGGACTATGCGCGAGGCATCGACCGGACTGAGGTAGGAGGCCATCCGG
TGCGCAAATCTGTGTCGGCTGAGGTGAACTGGGGCATCCGATTTGTCAGCCAGGAGGAGGCGGAGGAGTTTGTGCTGAAT
CTCTGCAAAGAGCTGGAGCGACGATTGCTAAACGAACAAGTCCGGGGCAAGAACCTGACAATGAAGATCCTGAAGCGGGC
TGCAAATGCACCGCTGGAGCCTGAAAAGCACCTCGGGCATGGTCGTTGCGACGTTTATAACAAAAGTGTGGTATTCGGTG
TGGCAACGCATAGTGCCGAGGCCATCGGCAAGGAGGCTGTGTCGATCCTGCGGTCATTCCGGTTCAGCCCCGGTGACCTG
CGCGGTTTGGGAGTGCAGCTGCAAAAGCTGGAGCCGATCAAGCCGATCAAGTCGATGGCAGCGGCGCCTGATGGGAGCCA
GAAGAAGCTGTCATTTGGTGGTGCAGAGAAGAGGAGCACTGACGGCGGCCAATTGTCGCCGGGGGAGGTTCCTGCCTTGG
CCAGCACGCAATTCGTTCTGCCTCGAGACGTGGACCCGAGTGTTCTGGCAATGCTACCTGCGGAGATTCGGCGGCAGCTT
GTGGCAGAGCCAGAAGTGATTGAGTCCAAAGTAAGCGACGATACTGGCAATGGTAGAAACAGCATCAGAAGCACGAGCGG
CCCCAACGAAAGCGGCAGCAGGCACCAATCGCCAATCAAGATGTGGTCCAGGGTGCAAAGTCCAGTGAGAGCAGCTGTGA
CTAGTTTTGCAACGGACGACATGCCAGCCGACATCGATATGGATGTGCTGGGTGAACTTCCGGAGGATGTGCGTGCCGAG
GTGCTCGCACAATACAGGCAGCATCAGGGGCGCCAATCGAACTCGCCTGCAGCATCACCCCACAAGGAGAGGAATAGCAC
CAGAGGTAGAGGTAGAGGTAGAGGAAGAGGGAGAGGGAGGGGGAGGGGGGGGGGCAGCAAAATTATAGGGCAACAAGGCG
TCAGGCGAAGTCTCTGGGGTACTCGAGGGGGAAAAGGTGCTACCGTGCTAACAACCCGAGAGCGACAACACGATGCAGCG
GCCAATCGGGCTCAATCAACCTTTGTTGCGGAAAGTAGGCAGCCACACGCTGGCAGTAACCAGGAGACTGAAAATAACGG
CACGCCACTGCTGGAGGAGCCAGATCCGGCTGTCCTGGCTGCGCTTCCAGAGGACATCCGAGCAGAGGTCTTGGCGGATT
ACCGACAGAGACGGCTGGAGCATCAGCAGGAGATGGCGACAAAGGGATTGCTGCGGTTGGAAATACCGGTAGTGGTGGCA
CGACGAGGAGCTGGCGATGGCGATGGCGGCGGAAGCAGCGTTGACAAGATGCAAGCGATGCTACAATTCCCAGCAATGCC
AGCCAAGATGACTTTGGGGGCAACAGCGTCAGGATCTCGGCTGTTGTCTGTGCAGGAGACCAAAAGCATGATCCGAACAT
GGCACGAGGCTACATGCGAAGAGGGCCCACACGAAGCGGACGTGGAGGTGCTAGAGCGGTTTCTGGTCGGTGTCGTGTTA
GAGGAACGAGACATGGACAAGGTGCGGAAGCTGATTGCCTGCTTGGAATGGCTAGTTGAAGAGGGGGTCGAGAAAGACGG
GGAGGATGGCGAGGGAAAGAGCCTGGGAAGACGGGCCTGGCGGCTGGCTGTGACGCAGATGAAGGATGCAGTGCAGAAGG
CGATGGGAACGAGGGGACTGGGGCCGATGCAGTTTGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62