GenePrediction:GLEAN_2765 Details

Name: GLEAN_2765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3126212..3127688 (+ strand)
Length: 1477
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3126212..3127555 (+ strand)
Length: 1344
Type: CDS
Source: GLEAN
Position: GCSC_140:3127632..3127688 (+ strand)
Length: 57
>GLEAN_2765 class=GenePrediction position=GCSC_140:3126212..3127688 (+ strand)
ATGAAGGGACTCGCCAACATCGCCGTCGCTGCGGCCTTCGTCGCCAGCGTCGCAGCCGACTCTCACGGTCACCACCACGC
GCGCAGGCTGGCACAAGGCAGCCCTGTAGCCAAGCGTGCTGCTACTGTTGCGTACGAGACCGCCTACGTCTACGCGGACG
GCTCGCCCGTGTCTACGGACGAGGCCCACGAGTGCATTGACGACGGCAGCTGCATTGTCCTCGGAACGGCCACGCCAGTC
TACACGTCGCCTGCGCCAACATCGACGTCGACCTCTTCCCTGAGCACCAAGGAGGCCCAGGAATTCTTCGAGTCCAAGAT
CACGAGCTCGTCCACGTCGAGCTGGTCGACCTCGACCGCCTGGACCTCGACGTCCACGAGCACCAGCACGAGTTCGTTCA
GCACCAGCACCAGCACCAGCTGGAGCAGCACAAGCACGAGCTGGAGCAGCACGAGCACGAGCTCCTCATCGACGTGGTCG
ACGTCTACTATCAGCAGCACGTCCTCATCAGCGTCTGCAGCGGCCAGCAGCAGCAGCAGCAGCACCACCACTGTCTCGGG
CTCGGGCACGAAGTTCCCCAGCGGAACGGTCAAGTGCAGCGAGTTCCCGTCGGCGTACGGCGCGGTGGCCGTTGACTGGA
TCGGGCTTGGCGGCTGGGCTAGCATCCAGACCACGGGCAGCTGGACACCGGGCTCGCTCATCAGCGACATTGTCGAGGCG
GTTAGCGGCGGCTGCACGGAGGGCTCGTTCTGCTCGTACGCCTGCCCGGCTGGCCAAACTAAGGCACAGTGGCCGACGAC
CTCGCAGGGCGCAACGGGCCAGTCGATCGGCGGTCTGTGGTGCAACAGCGACGGCTACCTCGAGCTGACCAACGACAACT
TTGACACGCTCTGCCAGGACGGCCTCGGCGGCATCACGATCAAGAACGAGCTGTCGGACGAGGTGGCCGTGTGCGGTACC
AACTACCCCGGTAACGAGATGATGAACATCCCGGTGCTGGCGGGCGCGGGCGAGACGGTCACGCTCACCAACATGAACGC
TAAGACGGGCTACGAGTGGGAGGGCAAGTACACCAGCGGCCAGTACTACGTCAACAACAAGGGCGTCACGCTGGAGCAGG
GCTGCGTGTGGACCAGCGCCGACTACCCCGACTCTGCCGGCAACTGGGCGCCGGTCAACATTGGTGCCGGTACCGACATC
TATGGCGTGACGTACATCTCCATCTTCCCGAACACGCCGACGTCTTCGGCCGAGCTCGACTTTGACATTGAGATCACCGG
TGACATCAACGGCGATTGCTACCTCAAGAGCGGCTCCTACTATGGCGGCGGCAGTGGCTGCACGGTACGTAACATGTTGA
TATTTCTGATGTTTCTGTTACTTTTGACGTGTTTGGATCTTCTTGCTAACGTGTGCACAGACGTCTCTCACCACCGGCGG
CAGCGCTGTCATCAAGTTCAAGAAGTACGGCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62