GenePrediction:GLEAN_2766 Details

Name: GLEAN_2766
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3128844..3133538 (+ strand)
Length: 4695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3128844..3132766 (+ strand)
Length: 3923
Type: CDS
Source: GLEAN
Position: GCSC_140:3132818..3133538 (+ strand)
Length: 721
>GLEAN_2766 class=GenePrediction position=GCSC_140:3128844..3133538 (+ strand)
ATGATGGTCCGGAGAGCTTTACGGGCAGCGGCCGCACTGGCCGTGCCTTTGTGGTGGGCATTGGGCGCCACGACAGCAGC
CTGGGCTGCCAAGGACGACCCCGAGATCCACGTCAGCTCGTTTTCCTACACACCCGACAGCCTCAACTACTTTGAGGACT
CGGACGTGATCCTCTTCCACGACTACGTCGACGGTGTTATATTCCGGTCCGTCGATGCCGGCAGCAAATGGGACAAGGTG
GCGGCCATCCCGGCCCAGGAAGCGTCGCGTCTCATCATGCACGACTTCGACCCCACGCGGGCATACGTGATGACAGAAGG
CGTGGTGCACTACCGCACCGACGATCGTGGCAAGACGTGGCAGACATTTTTCACCGATGCCGAGCCCAGCTTGTTCCAGT
CCGATTTGCTCGTCTTCCACGCCCACGACCCCAACCGGATCATCTTTAACGGCATGGACTGCATCGCCGGCAGCTGCATC
GAGGTGGCCATGTACACGACAGACGGCTTCCGCACGGATGCGCGGTTCCTGCGCGGCAATTCAGCCGGCTGCTGGTGGGC
CTGCTCGACCGATTTGTTCAGCACCGGCTCGGCCGACCTCGACGCCAGCCGGATCCTCTGCATCGTCAAGGACCCACGGT
CGATCCTCAAGCAGGACCAACGGCTGGTGGTGTCGGATAACTTCTTCCAGGCGACGACGGCGGACGGGACGATCCAGGAG
TTCGAGCCCAACCTCGACACGGACCGGCCGATCCAGGGAATCGTCAACGTGGCCCCGGTGAAGAAGTACCTGCTGGTGGC
GACGACGTCGCTCAACACAGACGAGATGGCGCTCTTTGTGACGGACGACACGCTCCGGTGGCACCGCGCCGTCTTCCCGA
CGGACCACCAGATCAACCAGGAGGCTTACACAGTGCTGGAGAGCACTAACTACAGCCTCCAGATCGACGTGATGACGACG
CGGCCGTCTGACCCGATGGGCGTGCTGTTCACGAGCAACTCGAACGGCACGTTCTTCACGCGCAACGTGGAGTACACTAA
CCGCAACCAGCGGGGCCACGTGGACTTTGAGAAGATCTCGGGCATCCAGGGCATCTTCCTGGTCAACCGGGTGGAGAACG
GCAAGGCGGTCGACAGCGACCGCGCGCAGAAGAAGATTGTGACGGAGATCACGTTTGACGATGGCCGGACGTTTGCGCCG
GTGACGGTGGGCGGCAACGACCGACTTCACCTGCACTCGGTGACGGATCTGAGCAACATTGGGCGGGTGTACTCGAGCCC
GGCGCCGGGGCTGGTCATGGCCATTGGCAACAAGGGCGAGTCGCTGGGCCGTTATGCGGACGGGAACCTGTACGTGTCGG
ACGACGCGGGTGTGACGTGGATCGAGGGTCCGAAGGGCCCACATAAGTACGAGTTCGGCGACCAGGGCTCGATCCTGCTG
GCGGTACACGACGCAAACGACGTGGGCGAGGTGACGTACTCGCTGGACCATGGGCGGACGTGGCGGACGGCAGCGCTGCC
GGAAGGCCTCCGGGTACGGCCGCTGATCCTGACGACGACGCAGGACTCGACGAGCCTCAAGTTCCTGCTGGTGGCGGACA
CTAAGGAGAAATCGCTCATCATCGCGATTGACTTTGAGGGCCTGCACGAGGCGACGTGCAAGCCGGACGACCTGGAGGAC
TGGTGGGCGCGGGTGGACGACAAGGGCCAGCCGACATGCCTCATGGGCCACACGCAAAAGTACCACCGGCGCAAGAAGGA
GGCAGCGTGCTTCCTCAAGGCAGACTTCCGAGACCCGGTGGTGGAGACGACGGACTGTGACTGCACGGACAAGGACTTTG
AGTGCGACTACAACTTCCGGCGCAACGACAAGGGCGAGTGCGAGCAGGTGGGACCGGTGCATCCGCCGGAGGGAGCGTGC
GGCCGCGACGCGAAGGCAGACGCGACCTTTAAGGGGTCGTCGGGCTGGCGGCTGATTCCGGGCAACACGTGTCGGCGCAG
CAGCGGGCAGCAGAAGGACGAGCTGGTGCAGCACAAGTGCGCAGACTCGGCGGCGCCGCCGGCAGCACCAGCATCGGGCA
AGGTGGCGCACACGACGCAAGAGCTGGGACTGCAGCGACAGTACGACGGGTTTGAGAAGCACTACCTGGAGCGCGGCGAT
TCGAGCGCGGTGGCGGACGAGACGATCATCATGCGGCCGATCAGCGGGACGTCTGAGGGCGGGCCGATTTTCGTGACGAC
GGACCACGGCAAGACGTGGACGCGGCCGGCAGTGTTTGACGACCTGGCAGTCTGGGCGATCGTGCCGCACGAGTTCTTCA
GAGAGGCAGTCTTTTTCGTGACGGCGTCAGGACGGGTGATCTACACAATCGACCACGGCGAGCACTGGCACGAGTTCCAG
GCACCGTATCCACCCGACATGCGCAACCGACGGACGCCGCTGTCGTTCCACGCGGACAAGAAAGACTGGCTGATCTGGGT
GGGCGAGAAGTGCGAGGGCACGGGCGAATGCTCGGTGGAGGCGTCGTACTCTTTGGACCGCGGCGACAACTGGCAGACAC
TGCTGCGATACGTGGAGCGGTGCGAGTTCATCGGGTCGAGCGCGTACCGGGTGCGGTCAGCCGAAGAGGTGCTCTGCCTG
GCGCGGGCACGCGAGGCGGGCGGGTCAGCGGCGGAGAACCCGCTGCAGCTGGTGTCGAGCAGCGACTGGTTCCGCGACCA
CAAGGAGGTGCACGAGCAGAATGCCAAGGGCTTCGCGACGATGGCCGAGTTCATCGTGGTAGCGGCCGAGGACGGCGAGC
GGAAGAGCCTGCGGGCGTTGGCAAGCCTGGACGGCGAGAAGTATGCGGAGGCACAGTTCCCGGCCAACTTTGACACGCCG
GAGCAGCACGAGTACACGGTGCTGGACAGCTCGACGCACGCGGTCAACCTGTTTGTGGCGACGGAGACGCGGGAGGACCA
GCGGTACGGCACGATCCTCAAGAGCAACTCGAACGGGACATCGTATGTGCTGAGCATTGCGGGGGTCAACTGTGACAACC
GATACTACGTCGACTTTGAGAAAGTGCTGGGGCTGGAGGGCGTGATGGTGGTGAACATGGTGGCGAACCGGGACGATAAG
GACAAGGCGGCGAAGAAGCGGCTGCAGACGAAGATCAGCCACAACGACGGGGCCGAGTGGGCATTTATGCCGCCGCCAGA
AAAAGACCGGGAAGGCAAGGCGTACGGGTGCCGGCCGAAGCTAGGGGCGAGCGAGGGCGGCGATCCGGCGTGCGCGCTGC
ACATTCACGGCTACACGGAGCGAGAGGACAGGCGCAAGACATATTCGTCAGCCGGTGCAGTGGGTCTGATGTTTGGCGTG
GGCAACGTGGGCGACAGCCTGGGCGAGCTGGCGACGGCCGACACGTTCATGACCACGGATGCAGGCCTCTCGTGGCGCCA
GGTGCTCAAGGGCGCGTGGACGTGGCAATTTGGCGACCAGGGCTCGATCGTGGTGCTGGTGCCGCGACACGGCAGCACGC
GGACGGTGCAGTTCACGACAGACGAAGGGGCGACGTGGCAGGAGTACCAATTCAGCGAAGACGAGGTGGAGGTGCTGGAT
ATCACGACGCTGCGGTCGGGGGCCTCGCGCAATTTTCTGCTGTGGTGTCGACGGGGAGGCAGCAGCGCGGCCGTCTTCAC
GATCAACCTGGACTTTACCGGCCTGGCCGACCGGCCGTGCGAGCACAACGACAAGGACGCCAAGGCGTCGGACTACTACC
TCTGGTCGCCGTCGCATCCGCTGATGCCGCAGTCGCAGTGTCTGTTCGGACATGTGACGCAGTATCTGCGCAAGAAGTCG
GACCGGACGTGTTACAACGGCTTCCGGCTGCAGCACCTGTACAACACGGAGAACTGCACGTGCAGCCGGCGAGACTATGA
ATGGTGAGTGAATTTGGTGTGGGTGTAGTAGTGAACAAGAAGACTGACAGACAGTGACTACAACTACGAACTCGACAACC
ACGGACAATGCTCACTGGTGCCGGGGCTGGAGCCGCTGTCCAAGGAGCAGTGGTGCAAGGATCATCCAGACGCCGTGGAC
TACTACCCGCCGTCAGGCTTCCGGCGCATTCCGCTGACAACGTGCTCGGGCGGCGACGAGTTCGACAAGCAGACGGTGCC
GCAGGCCTGCAGCAACCACGAGGACGAGTTCCAGCGCAAGCACCGCGGTCCAGGTGGCCTGGTCATCTTCTTTGCCGTCG
TCATTCCGGTCAGCATGGCTGCTGCCGTCGGCTGGTGGGTCTACAGCAACTGGACGGGCAAGTTTGGGTCCATCCGGCTG
GGCGAGAACGGCACGTCACGTTTTGCGCTCGACGGCAACGCTCCATGGTTCAAGATCCCGCTGATGGTGCTAGCCGGCGC
TGTGGCTGCCTTGGGCACGCTGCCGCTAGTAGCCTCGACCGTGTGGCGGACGACGACGGACGCGTTGGGGCGCTGGACCG
GACGCGGCAGTGGTGGTGGTGGTGGTGGTGATCGCGGCCGGGGAGCCTGGAGCCGGATTGGCCAAGGCTTCGGCTTTGGC
AGCAGTGGGCGTGGTTCAGGCGGCACGCGACGGTTTACCACACGTGACAGCTTTGCACGTGGCCGGGGCGACTATGCGGC
CGTGGACGACGACGAAGGCGAGCTGCTGGGGGATGACAGCGAGGATGAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62