GenePrediction:GLEAN_2769 Details

Name: GLEAN_2769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3159619..3162053 (+ strand)
Length: 2435
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3159619..3159767 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:3159836..3160155 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_140:3160219..3161163 (+ strand)
Length: 945
Type: CDS
Source: GLEAN
Position: GCSC_140:3161220..3161243 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:3161295..3161477 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_140:3161557..3162053 (+ strand)
Length: 497
>GLEAN_2769 class=GenePrediction position=GCSC_140:3159619..3162053 (+ strand)
ATGGCATCGCAAGATTCGGCGGGCGACCCTGTGAGCGCTATGCGTCAGCGCTTCGGTGGATATCTGCCGATCGAGAACTA
CGGCATCATCGGCAACATGCGGACCTGTGCTCTGGTCGGCATGGACGGCAGCATTGACTTTATGTGTTGGTAAGAGGAAA
TGGGAGGGCTTGGAGAGAGAGAGAGAGAAGAAGACCGAATTCTGGCTAACCTTGCAGGCCGGATTTCGACTCGCCGTCCG
TCTTCTGTCGCCTGTTAGACAAGGATAAGGGCGGGCATTTCAGCATCTCGGCGTCGCCGGAGATGGCCTGCACCACCAAG
CAGCAGTATCTGCCTTCGTCCAACATCCTGCTGACGCGATACATCCACGAGGACGGTGTGGTGGACATGGTGGACTTTTT
CCCGCGGCCCAAGGCGGCCGCCGTGGTGACCCGCGGCGTCAAGCAGGGGCCGTTCCGCGAGGCCCAGCGGGTGCAGGAGG
AGCTGAAGAAGTGGCTCGTCCGCCGGGTCGAGTGCATCCGGGGGCGCTTTGAGCTGGGTGAGACGGCCTTCTGTGCTGTA
TGCGTGTAGCTGTCCGTGTCTCTGCTGACGATTGCGGCAGACGTCGAGATCTTCCCGGCCTTTGGCTATGCTAAGGAGCC
GCACACTACGACCATCGAGCAGGACGTACACCACGTGAACAGCCCGGCGAGCAAGACGGTCACCTTCCGCAGCCGAGACC
TGCAGCTGCAGCTGGACATTGCCGTGGACCGCGACGTCGACGGGGCGAGCGGGACCGCGGATGTAGGTCCCGACGGCCTG
CGCGGCCGCACGAGCAGCGTGGGCAGCGGCGGCGGTGGCCCGACCGTCGTTTTCCGCAAGCAGCAGCGGACAGGCATGAC
GGGCGAGGGCGTGGTCGCACGCATCGTCCTGCACGAGGGCGAGAGCGTGTCGTTTGTGCTGCGGGACGATTCGCCCAGTC
ACGTGACCAGTCACATCACGACGCAGGTCCTCGACAGCCAGCAGCACGACACGCAGCTGTTCTGGTACAACTGGATCGCC
AAGAGCCGCTACAAGGGCCGTTGGCGCGAGGTCGTCTCGCGCAGCCTGCTCGTGCTCAAACTGCTCACGTACGAGCCCAC
CGGCGCGATCGTGGCCGCGCCGACCTTTTCCATCCCCGAGGACGTCGGCGGCCGTCGCAACTGGGACTACCGTTACTCCT
GGGTTCGCGACAGCAGCTTCACCGTCTACATCCTTCTCCGCCTCGGCTTCAGCGAGGAGGCCGAGGCCTTTGTCGCCTTC
ATCAGCGAGCGCATCCTCAAGTCCCGCAGTCCCGACGGCGGCCTCCCGATCATGTTCACTATCCGCGGCGAGACCGACAT
CCCCGAGATCGAGCTAAGTCACCTCGCCGGCTACAAGGGCAGCCAGCCTGTTCGGATTGGAAACGGCGCCGCCTTCCATC
AGCAGTTCGACATCTACGGCGAGCTGCTCGACGCCATCTACCTCGCCAACAAATACGGGAAGCCGGCCACTTGGGACCAG
TGGGTGTCTGTCCGCCAGCTGCTCGGTACGTGTGATCCCGCATAGGTCATACTCATCTGGACAAGCCACTGACTCTTCTA
GATTATGCCCTCACCATTATGCACGGTAAGACGAATCCCCATCGTCCGACCAAGACTCTATATGCTGACTAAGCAGATCC
TGACATGTCTATCTGGGAGGTCCGCAACCACAAGCAGCACTTTACCTACTCGCAGATCATGCTGTGGGTGGCTTTTGATC
GCGGCCTGCGGCTCGCCGAAAAACGCAACCTGCCGTGCCCCAACCGTGCCAAGTGGCTCGAGGCCCGGGACTACATCTAC
GAGGCCATCATGGAGAAGGGTGAAGCTTTCCCTTGTCTCTTTTGCTACATTCATAGCTTGTATGACTGTGCTGACCATGT
TCAACCTCTTGCTCACAGGCTACAATACCGAGATGAAGTCGTTTATCCAGAGCTTCGAGAACAACACCGCCCTAGACTCG
TCCATCCTCATCGCCCCTCTGGTCTTCTTTATTTCGCCCTGCGACCCGCGCTTTCTGTCCACGCTCGACCGCATCCTGTT
GCCCCCTGAGAAGGGCGGCCTCACGAGCACTGGCCTTGTGTACCGCTACGACACGGAGCTGTCTGCCGACGGCGTCGGTG
GCCGCGAGGGCGCCTTCAGCATGTGCACTTTCTGGCTGGTCGAGGCCATGTGCCGCGCCAGCGTCTACGAGCCGCGCTAC
CTGGCGCGAGCTGTCAATCTGTTTGAAAACATGCTGAGCTTCGGCAACCATCTCTCCATGTTCTCTGAGGAGATCTCGCG
CAGCGGCGAGCAGCTCGGCAACACGCCTCAGGCCTTTAGCCACTTGGCCCTGATTAGTGCTGCCTTCAATCTCGACCGTG
TCATCGAGTCTAAGAAAAGCGACGATAAGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62