GenePrediction:GLEAN_276 Details

Name: GLEAN_276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:731122..732110 (+ strand)
Length: 989
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:731122..731138 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_167:731341..731353 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_167:731500..731629 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_167:731713..731976 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_167:732046..732110 (+ strand)
Length: 65
>GLEAN_276 class=GenePrediction position=GCSC_167:731122..732110 (+ strand)
ATGTCTGGCGATCTTTGGTAAGTAGCTATTTGCTCATTCACTGGCTTCACAAAGCTACACCCAATGCACCGACCTTCAAT
TGCACATGGATATAAAGCTCCATTGCCTGCCACTGCCATGACGGACGCCTCGGATAGCTGCGGCTGCATTGGAAGCTTCC
ATCGTGATAGCTATGACATGTTAATATATGAACATCGCTGACTGTTGTCTCTTTTCTAGCCCCGCCTACGCGGTTAGTTT
CTACCCTTCTCGATTTCATCTACCGACTTAGTCTATCGATGCCGTGCCCAAGACGACATGCAATACGAATGCCAGCACGC
GTTTCTGGGTTCCGCCCTCAGACAAATGAGCTTTAACTAACTTCTTGCTACGCGATAGCCCTTCTTTGGTGCCATGGGCT
GCACGGCTGCTATTGTCTTCACATGCCTGGGTGCTTCCTACGGCACAGCGAAGTCTGGTGTCGGTATCTCTGCCATGGGT
GTTCTTCGGCCTGACCTGATCGTCAAGAGTGCGTCTTTCATTTGACATCTCTCAGTCCATCCAATTGCCCTTGGTATCCC
GCTCATGCCTTGCTTACACACGTCCCTCTAGACATTGTCCCCGTTATTATGGCCGGTATCATCGGTATCTACGGCCTGGT
CGTTTCCGTCCTGATCTCCGACAACTTGAAGCAGCACGAGTATGCCCTGTACACGGGTTTCATCCAGCTTGGTGCTGGTC
TGGCCGTCGGTCTGGCCGGTCTGGCTGCCGGCTTTGCCATTGGCATTGTCGGTGATGCTGGTGTTCGCGGTACTGCCCAA
CAGCCGAGACTGTTTGTCGGCATGATCCTGATTCTCATTTTTGCCGAAGTCCTGGGTGCGTTCCTTAATTCTGCAGCCCA
CGCGTTTATTGCCGCTTGTTCTATTGCTAACACACGAATTTTAGGTCTTTACGGACTGATTGTCGCTCTTCTGATGAACT
CAAAGGCCACCATCAACGTCAGCTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62