GenePrediction:GLEAN_2771 Details

Name: GLEAN_2771
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3168264..3169643 (+ strand)
Length: 1380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3168264..3168614 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_140:3168688..3169250 (+ strand)
Length: 563
Type: CDS
Source: GLEAN
Position: GCSC_140:3169316..3169643 (+ strand)
Length: 328
>GLEAN_2771 class=GenePrediction position=GCSC_140:3168264..3169643 (+ strand)
ATGGGCAAGACCAAGGAAGTCAAGGTCAAGAAGAGCGCCGAGGCGGCTGCTCCCAAGACGGTTAAGGCAGCTGCTACCCC
GTCCAAGAAGTCTGCCAAGGTTTCGAAGAAGTCCAAGAAGGAAGAGTCATCTTCTGAGTCTGAGAGCGAGGAGGAGTCCG
CGTCTGAGGCCTCTGCCGACAGCGAGGACTCTGACGACTCCGAGTCCGAGGCTGAGGAGAAGCCCAAGACCAAGACCAAC
GGTGCCAAGGCAAAGAAGGAAGAGTCTGACTCGGACTCGGACGACTCTGACGACTCGGCTGACGAGAAGGAGGAGAGCAC
CGACAAGTCGGACGCTAAGAAGGACTCTGACGTGAGCATACCCCTCATTTCCACCATCTACACCCTACATATCGGTGGCC
TCCATGCTAACAACATGGCAACAGTCTGAGAATGACTCTGATGACTCTGACGAGTCCGACGCCGAGGAGAAGAAGACTGA
GGAGGAGCCGTCCAAGAAGCGCAAGGCTGACGACGAGGAGCCGGCCGCTGCCAAGAAGGCCAAGACTGAGGAGGAGGGTG
AGACCTCTTCCACGCTCTTTGTCGGCAACCTGAGCTGGAACGTGGACGACAGCGTCCTGTATGACGAGTTCAAGGGCTTC
GATGGTCTGACTGGCGCCCGTGTCATCACGGACCGCGAGACCCAGCGCTCGCGCGGCTTCGGCTACGTCGAGTTCGACTC
GGTCGAGCACGCCCAGGCTGCCTTTGACAAGATGACCGGCTACTTCCTGGACGGCCGCGAGCTGAAGATTGACTTCTCCA
CCGGCCGTGCCAAGAGCAACGATGCCAACCCGGCTGCGTCGCGCGCCAAGAAGTACGGCGATGTCACCAGCCCGGAGAGC
GACACCCTCTTCGTCGGCAACCTGTCGTTCGACGCCGATGAGGAGACCGTCTCGGCCTTCTTCAGCGAGGTCGCTAACGT
CAAGAGCCTGCGTCTGCCTACCGACATGTAAGCATCCTCTCTCGCAATTGCCCCGCTCTTCTACATGCAGCATGCTGACT
CATTTTACTTAGGGAGTCTGGTCGTCCCAAGGGCTTTGGCTACGTCTCGTTCTACTCCCTGGAGGACTCCAAGAAGGCGT
TTGACACTCTCAACGGCCAGTCCTGCGCAGGCCGCAACGTCCGCCTGGACTACTCTACCCCCAAGCCGAGAACCGAGTTC
GGTGGTGACCGTGGCGGCCGTGGTGGCCGTGGCCGCGGTGGCGGCTTCGGTGGTGGCCGTGGTGGTGGTGGCGGCTTCGG
TGGTCGTGGCCGGGGCGGTGGTGACCGTGGTGGCCGTGGCCGTGGCGGCTTCGGTGGTCGTGGTGGTGGCGGCTTCGCGG
GCAAGAAGACCACCTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62