GenePrediction:GLEAN_2775 Details

Name: GLEAN_2775
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3182544..3182958 (+ strand)
Length: 415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3182544..3182574 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:3182637..3182656 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_140:3182764..3182958 (+ strand)
Length: 195
>GLEAN_2775 class=GenePrediction position=GCSC_140:3182544..3182958 (+ strand)
ATGTCGGCCCTTTTATACGGCTACGTCGAGAGTAAGATATTTTCCCATGTTTCGTCTCATCGCGCCTCCGCTCCCAGCTG
ACTTTCCCCCCAGAAAAGGTACTCGTTCTCACGGTGGACTCCCGCATTCTAGTTGGCACCCTGGCATGTATCGACAACTC
GACCAATCTAGTAGGGACCCTTGAACTTTCCGGATGTGCACACCGGCTGACCTCTTTCAGGTACTGCAGTCTGCTATCGA
GCGTGTGATCAATACTCCTGACGATGCCGAGCCGTCGGCCGAGGTGCCACTGGGCCTCTACATTGTGCGTGGTGATAATG
TGTGCAGCGTCGGATTGGTGGACGAGGAGCTGGATGCGTCTATAGACTGGAGCAAGGTCAAGGGCAGTGTAATTGGAACG
ACAAAACATGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62