GenePrediction:GLEAN_2778 Details

Name: GLEAN_2778
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3193228..3194282 (+ strand)
Length: 1055
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3193228..3193284 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:3193422..3194282 (+ strand)
Length: 861
>GLEAN_2778 class=GenePrediction position=GCSC_140:3193228..3194282 (+ strand)
ATGGGCTCTATCGAAGAAGAGCGGGACGAGTATACGGTGCTCGTGACGGGCTTTGCGGTAGGTTGCATTTCCAGCGTTCC
GTGAGCTGTGATGTTGTGGAGAAGAGTTGTGTGGTGGGGAAGAGGAGACGAGAGATGAGAGCCAAGAGACAAGAGGCGAG
TTGTCTGCTGACGATGCTGTTTCTGTCGCTGCAGCCGTTCCGGGACGAATACCCGGCGAACCCATCGTGGGAGATTGCGA
GCAGGCTGCCGGCCTATCTGCCAGCAGCAGCGTTGCCGTCGTCGACAGCCGACCAGGAAGGATTCCCGCCGGTGCGCATC
GTCGTGTATCCTGAGCCGATCCGGGTGGCATTCCGAACGGTGCGTGACCTGGTGCCGAAGCTGTGGGACGGCCGGACGGT
GAAGCTGAGCGGCGGTGGCGCCTTTACGCCGCCACGGCGCATCGACCTGATGCTGCACATCGGCATGGCCGGCCCGCGGC
TGCACTACTCCATCGAGCGCATCGGTCGCCGTGACGGCTACCGCATCGCCGACGTCGACGACTGCCTGCCAACGGTCGAC
AGCACGAATCGGCAGTGGGCTTGGTATGGCGTGCCGCCGTCGCTGGAGTCGCATCTCGACCTCGACGACGTGCTGCCGCG
CTGGCGGGCTGCTGTTGCCGCCGTGTCGCCGGAGTCGCCGCCGGACCTGCGTGTCTCTATCGATGCCGGCCGCTACCTCT
GCGACTTTACCTACTTCTCGTCGCTGGCCCATCTCTACCGCCGTGGACGCGGCGATCCCGTCATCACCAACGACCAGGTC
ACCCTGCCCGATCCCGACAGCCGCCTCCGCGTCGCCTTTCTGCATGTGCCCGCGTCGGCCGCGCCCGAGCGCATCGCTAC
CGGCCGTGCCGTCGTCGTCGAGCTGCTCCGGGCCCTCGTCGCCTCCGACCTGGCCGCCCGCGCGATGACTCAACCTGTGG
TCGTGACCGCCAAGCGGGGGAAGCAGCGGATCGTACAGGCCGACGACGACGCCCCCGCGGCCGGCGTGCCGACGGACAAG
TGGTACTGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62