GenePrediction:GLEAN_2779 Details

Name: GLEAN_2779
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3197323..3199101 (+ strand)
Length: 1779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3197323..3197559 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_140:3197615..3198011 (+ strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_140:3198105..3198648 (+ strand)
Length: 544
Type: CDS
Source: GLEAN
Position: GCSC_140:3198711..3199101 (+ strand)
Length: 391
>GLEAN_2779 class=GenePrediction position=GCSC_140:3197323..3199101 (+ strand)
ATGATGGCGACCAGGGGCATTGACGACAAGAATGCGGTGCAGCAGGTGTCGGAAGATGCCAGCGAGAAGAGTACGGCCGT
TCCGCCGGCAATTGTGGGCGACAATGCGGAGCTGTACCGCGAGGCCATTGCGCGGTATCCGGACGAGAGCTCCATCGACG
CCGAGCTGGAGCGGCAGGTTGTGCGCAAGCTGGACCGCCGCATTCTGCCAGTGCTGGGCCTGTGCTATTTCTTCTACGTG
AGTTGCGTCTGCCATCTGCCATGTCCGCTTCCAGGCCTGCTGACACGGCCAGTATGTCGACAAGACCACGCTCTCGTATG
CGGCCATCTTCGGGATCAAGGCCGACCTTGGCCTGCACGGCCAGCAGTACTCGTGGCTCTCCAGCATGTTTTACTTTGGC
TGGCTCTTCTGGTCGATCCCGTCGAACCTGCTGATGCAGCGAGCCCGTCCGGGCTGGTATCTAGCCCTGAATATTTTCAT
GTGGGGTGTCTTCTTGATGTGCCAGGCGGCGGCGCAAAGCTTCGGCGCCGTAGCAGCGCTGCGGGTCATCTCGGGCGCGT
TCGAGTCGATTGCGGACCCGGCCTTTATGCTGTACACGTCCATGTTTTACACGCAGGCGGAGCAGCCGTCGCGGATCTCG
GCATGGTATGCGTGGAACGGGATAGGGGTGGCCGGAGGGGGGTTAATTGGTAAGTTTTCTGTCTATCTTTTTTTTTCTTT
CCTTTTTTTTCTTTATATGTTTCCCCTTCTCTTCCTCTCTGCTGCCCCTTCTCACACACCAGGCTATGGTATCGGTCAGA
TTAAAGGCGGACTCGCGTCCTGGCGCTACGAGTTCCTCATCGTCGGGGCGCTCTGCTCGGGCTGGGCGCTCTGTCTGCTG
GTGGCGCTGCCTAACTCACCGACGCGGTTCCGTGGTTTCTCGCACGACGAGCGGCTGGTGATGATCGCACGCATGCGGCG
CAACCAGACGCGGTTTGAGCAGCGCACGATCAACTGGACGCACGTGTGGGAGGCCTTCGCCGACTACAAGACCTGGCTCT
TCTTTCTGCTCGGGTTCGTGTCGAATGTGCCAAACGGCGGCATCTCCAACTTCTCTACGCTCGTCATCCAGGGCCTCGGC
TTCAACACGCTGCACACGGCTCTGCTGGGCATTCCGCAGGGTGTTATCGTCGTACTCTGGATTGGCCTCGGTGCTTGGGT
AAACCGGCATATGCCGCTCAACAGCCGCACGCTCGTGTGCGCCGCCTTTATGCTGCCCACGATCGCCGGTGCCCTGGGCT
TCTTGCTGGCGCCAAAGGATGCCTACGTCGGGCGTCTGATCTGCTTGTGAGTGGCGCTGTGTCTGTGGCTGTGCCCTTGT
CTGTGCCGGTCTGACCTCGGTGTCTCAGCTACCTGACTGGCTCGTATCAAGCGTCCTTTGTGATCTGCCTCTCGCTCGTC
ACCGGCAACACTGGCGGCCAGTCGAAGAAGATGATTGTAGCCGGCATGATCTGGGCCGGCGCCTGTGTCGGCAACATCTC
CAGCCCGTTTTTCTATCGGAGCAAGCAGGCACCAACATACCACCTGGGCATCGGGTCGCTGCTCGTGGCCAACTGCCTCG
AGCTGCTTCTCTTCTTCGTCTTTCGGGCCGTCTTCATCTGGGAGAATCGAAAGAAGGAGCAGCAGCGGGCAGAACTGCGT
GCGGACGGGGTCGTGACAGACGACTCGTACGGGCTCAACACCACCGCCTTCGGGGATCTGTCGGACAAGGAGAACATAAA
CTTTGTCTACGTATACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62