GenePrediction:GLEAN_277 Details

Name: GLEAN_277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:739721..740955 (+ strand)
Length: 1235
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:739721..740023 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_167:740131..740781 (+ strand)
Length: 651
Type: CDS
Source: GLEAN
Position: GCSC_167:740845..740955 (+ strand)
Length: 111
>GLEAN_277 class=GenePrediction position=GCSC_167:739721..740955 (+ strand)
ATGGCGTCCGCAGACATGTGGACGTTTCTGCAGGCCAATCCTGTGGCAGTGTCCATCACAGAGGCATGGAAGTCATTCTC
AGACCGACGTGACCGGTTGGGCCTCAGCAATCCGGGCACGGTCGAGGCTATTGCGAAGGAGGTGCAGCGCGATGTGCTGC
TCAACAACCACATGTTCACTGGCATCAAAGCCGACCTGACGAAGCCGTTTAGCGTGTCTCCTCTGTTCCAGGTGTCCCAC
CAGTTTGCCATGGGCGACCGGTTACAACCATACACGTTTGCAGCCCTCTACGGCACGAACAAGGTGAGAATCGACCGGAG
CCGGGGCGAGGCCGAGGAGAGGGACGGGAAGGAGGTTTCTGCGTGGCGATGAGAGGCCGTGGTGCTGACAGCATGTGCTC
TTCCGCATAGGTGTTCTGCCAAGGACACGTAGACAACGAGGGACAGCTGGCGGCCCGGTTCAACTACCGCTGGACTGACG
GGCTCGTCTCCAAGTCGTCGGCTCAGCTGGCTCCCGGCGACGGCCAGAGCATGGTCCAGATCGAGCACGAATACACGGGC
CGTGACTTCACGGCGTCGCTCAAGACGATGAATCCGTCGTACCTCGACGGCGGCCTGACCGGCATCTTCATCGGCAACTA
CCTGCAGTCGGTCACTCCCAAGCTGTCCATCGGCTTGGAGGGGGTCTGGCAGCGCGGCGCGCTGTCGCAGCCGCCCGATG
CCTTGCTCTCGTACTGCGGCCGGTATGCGTCGGGTGACTGGGTGGCCACGGCACAGCTGCAGACACAGGGTGCCATCAAT
GCGACGTTTTGGCGCCGCCTGGCCGAAAACGTGCAGGCCGGTGTCGATATGACCCTGCAGGTGGTGCCTAACGCGGCCGC
CGGCCTGATGGGTGGCGGCCTGCAGAAAGAGGGCGTCACGACCTTTGGCGCCAAGTACGATTTCCGCATGTCGACCTTCC
GCGCACAGCTGGACTCCAAGGGCAAGTTAGGCGTCCTGCTGGAGAAGCGGGTGGCCGCCCCCGTAATGATGACTTTCGCG
GCAGATGTGGACCACGCTTCGGTAGGCCTCGATTCCGTGACGTTGCTATAACCCCCCCCAGTTCCTACTGCTAACAGCCT
GCAGCAACAAGCCAAGCTTGGCCTAGGCATCTCGATCGAGACTGGTGGTGAAGAGATGGAGCTCAACCCCGACGGCAGCC
CCGTTCACGCACCACCAAACAACGTCCCGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62