GenePrediction:GLEAN_2780 Details

Name: GLEAN_2780
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3200217..3201591 (+ strand)
Length: 1375
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3200217..3200227 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:3200319..3201591 (+ strand)
Length: 1273
>GLEAN_2780 class=GenePrediction position=GCSC_140:3200217..3201591 (+ strand)
ATGGCTGACCAGTAGGTTTCCCGAACATTCGATGGATTCTTTCATTCTTGTCTTTTTCGTTTTTTGGTCCTTCGTCCTTT
GTCTCATCCACTAACCTCTCAGCTGTCCTGGCGACCTGGTCCGCGTCCGTGTCGGTCCCGACCAGCGCGAATTTGTCGTC
CATCGACGTCTGCTGTGCGCCTCGAGCGTCCTGTTCCGCGACAGTCTTGCGGCCGTGCCTGAAGGCCTGGCGTCTTCGGC
CGCCTCGTTGTCGTCATGTCCGGCCTCGGTGTCGCGGCCTCGGACGACGTCGTCGGCCATTGTGCTCTGGCTCGCAGCCG
AGTCAGCCGGCATGTTTGAGCTCTTTGTGTTGTGGCTCTACCGCGGCCATGCGTTCCGTGCGGCCATTGACGACATGGCC
GGTGCCAGTGCCGAGGAAGAGGTGCGGCTGCGGACACCACCCGGACTCGCATCGCCGTCGCCATCTTTGGGTGCAGCGCC
CTCCCGCAGCGACCTGCACTGGCATCTCGTGTACGCCCACCTGTTTGGTGCCCGGGCCGACATCCCGGCCCTGCAGGACG
CCGCCATGGACGCGCTGCAGGACCTCTACCTGCGGCTCGACTGGGAGGCCACGCCGCAGCTGATCGGCTTTCTCTACGGC
GACTGCGACGACGACCCGGTCGCGGCCTGTCGGCTGCGCAAGTGGGCCGTTGCCCTGCTGGCCTGGACGCTGGCGAATCT
GTCGAGCCGCGGCGACGCTGAGGATGCGGCCGCGCTCGGCCGCCTGCTGGTCACGTTCCCGGCCCTGCGCGCTGACTACG
ACGCCCATATCGACAAGATGGCCGCCAGCGCTGCCGACGTGCGGATCAAGAACCCGCAGCTGCGCATCCCGAGCAACCAT
CTGCGGCGCGATGACCGCCACTTTGGCTTCCGCCAGTGCTCCTTCCACAGCCATCGCCGCTCCGTCGGCCAGGGACGCTG
TCCGCACAGCCCGGGACTGCGGCAGGTCGCACAGGCTCAAAGTCCACAAGCTCAAGCTGCACAGACACAGACTTCACAGG
CCTCACAAGCTTCACAGTCTTCACAATCGTCTCCACAGCAACAACACCATCAACACCACCACCACCACCATCGCCATCAC
CACAGCAGCAGCTCCAAACACAGCAGACTGGAACAGACCACTGCCGTCCCATCACCAACGCCCTCGTTCTCGTCTCGCTC
TCACTCGGCCTCACTGTCCTCTTCTACCGGCACCTCGCCCTTCTCCCGCTCGTCCCACACGTCGTCACGGTCTAGCGCCA
CCTCGGACCCGCGTCTGGCCGACCTGTCCATCTGGCCGTCGCCGCCGGTCACCACCCCGAGACTGGCTCCCTTGGGCATG
GAGTCCACCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62