GenePrediction:GLEAN_2781 Details

Name: GLEAN_2781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3205529..3209620 (+ strand)
Length: 4092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3205529..3205584 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_140:3205767..3206381 (+ strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_140:3206479..3209620 (+ strand)
Length: 3142
>GLEAN_2781 class=GenePrediction position=GCSC_140:3205529..3209620 (+ strand)
ATGGCTCTTGAACTGCAACACCAGGGGACGGACCCCCTCCCCCTACACCCGACTTCGTCCTCCTCCTCTCTAGCCTCTCT
TTGAACTCACCTGCCTCCCTCTCTCCCACGTCCCCTGACACTGCTCGCGTTGGCGCCGAACACTCTGCCCCCCCTTTCAC
GCCTTTTGCTCCGTCTTCCTTTGAGTCTGCTCGCCGGCCATCCACCCGGCCGTCGCCCCTAACTCTCGGCAACAGCAGCA
AGGACAGCTACCCGCACCAGCCTAGGACGTCTTCGCTCAGCGCTCTGCCAAACGTTGCCACTATCACTGCCGTCAGCAGC
GAACGGAGGTCCCATAGTCTGGCCTACCCCGTGGTTAAGCCTTGCTTCATCCCGCCAGCGCGTCCTGCCTCGTCTGGGCT
CTCTGGTCCGATTCGACGAAAGCCTGTAGCCAGCACAGCCTCATTGGTTGAGCAACTCCCGGTCGTGTCCCAGGAACACC
AGCCTATCAAGGAAGAGGACGAGGACTACGTTGAAGAAGAGGAAGAACAAGCAGAAGATTACGAGTATTACGAAGGAGAC
GAAGCAGACGAAGCAGACTACGACAGTCACGACGAGCTGCACTTTTTGGATAGCATCGCCGACCTAGACGGTCTTCAAAA
TCTAGGGAATCTAGACCATCTGGGCGTCTTCGACGAGCTGCCCCGGCCTGATCAGAGATTTACGCGCTCGTACTCCATCG
ACAGCCCGACGCTGTACGAATTTCCAGGCCAATCACACAGGACTCACGACGGATTGTCATTGCCGCCTTTGCCGCCTTTG
CTGGTGCCGTCCTCCTTGTCTGTTTCGAAAAAGCCAGGCGACGTTGACAAAGAGTAAGCAACACTCGGCATCGTGCTTTT
GCCTTTGTGTGCCCCTTTCACCTTAATCCATTTGCCAATCGCGTTCTGCACCACTGACCAGGGTTCGCAGATCTCCGACC
GCCATTCCGGATTCGGGCTATCCCCAATCCCAGGACGCCGACTTTGAAGAAGCTGCCGCCCTGACCTCCCGAAACAGTCT
GTCCTTTACCCCTGCACCCCCTCAAACAGGTACAGCCGACGTTTCGGCACACCATGATAACGGTCTCGTCACGAACACAG
CCCGTGACCAGATCGACGTAAGACACTCATTTGAAGAGGACGAGGAACGAGAAGAGCCCAGACTGCAGCAGGAGCAGATC
AAAGAACCGGAAGAAGACCAAAGAGAGCCCAGCCCTACCATGTCCCTTTTCTCACGTAAGCCACCTCATCTCAGTTTGGG
AACGATTAGCAGCAACCACAGCGACAAAGACATCAAAGACGCGCAAAAATCACCCTCTGGCGATTCTCGGTACTCTACGT
ACCAGGACGAGCAAAGCCCTGTTTCTTTCTCTCGCCAGTCAATCAAGTCATTGACCCCGACCATCAAGCAGAGGCCCAAC
ACCCTCAAGCCGCTGCCCAAGTCGCCGGGCTCGTCCAAGCTCGGCAATTTCTTTGGCTGGGCACCCTCGCCATCGACGAC
CGAATTCTCTGACCAAGAATTCTCTCCGCTCTCTTCTCCCTACGCACTGCAAGCACCAGGCACCGTCGGCACTCATGCCT
CCATCTTGTCTACAGCAGGAACCAGCATCACATCCGTCTCCTCACAAGGCAGCGACTACAAGAACGGCGAGACGCATGCC
GTCAGAGACGACCTACAGACACCAGCGATCATTGCATCACAACCACAGCATTTACTGTCATCGCTGTCATCATCCAACGA
GATCGAAGAGATGGAGGAAGAGCTGAAGGCCATCAGCGCCGAGCTGGCTTCGTCCATCCGGCGAGAGATAGACCTAGAAG
ACCTTGTGGACAGGTTGCAGACAGAGATCAGCAACCCACAGGCACCGGGGAAGCGCACGAGCGACTACTATTCCGACTCC
GGCTACAGCTCCAGCCGGGCGATCAGCGACTACGATGCCGCAAAAGAGGAAATCGCACAGGTGCAGCGCCGTGCCGAGCA
GGAAAAGGCGCAGGTGCGGCTCGAGCTGACCCAGAAGCTGTCTGACGAGCGGACGCGCCGCACGTATCTGGACCAGCAGA
TCAAGGAGCTCAGCGAGCGGGCTACAACTCTGGATCTCGCCCAGACCCAGCGCAGCAACGAGGAAGTCAGCGGTCGCGTC
AAGCAGCTAGAAGGCGCCTGTGAAGACCTAAGGCGTCGCCTGGCGGAGGAGCGGAACGTCAAGGAGAACTTTGAGGACTT
GCTGTCGGCCATGAAGGGCGAGCTCCAGAGCGCCACCAACGAGCGCGACAACCTGCGCGATGAGGTGGTCCCACAGCTGC
GTGCCCGCGTAGAGGGTCTCGAGACGCAAGCTGCCGAACTGGCACGTCAAGCCTACGAGACCAGCAAGATGCAGCAGGAG
CTGCAGACGCTCAAGGAAGAGAACTCGAATCTGCGGGCCATCAGTACCAGCCTAGCTGCAGCCGAAGAAGGCGAGCAGCA
GGACGGAGTTTTCAAGCTGCAGCGGGCGCCGGCAGGACTGTCTCGGTCGAACACGCTGTCCCGATCCAACACGCTTTCGC
GGTCCAACACGGTGAAGCGGCAGCAGCAGCAGCAAGGCCAGGGCGCGGCAGCCCCGACAAGCACGATCAACGAGTCGCGC
GAAGTACTGGCCGAGCGGCTCCGAGATGTGGAGGCGCAGCGCGATGCATTGCACAACGCGCTGAAGAATCTGCTGGAGCG
CCAAGACTTCCAAAATCGTGAAAGCAGCAAAAAGGTGCGGATACTGGAGATGGAGCGCGACCGACTGTTGACGGCGTCTC
CCAAGAAGGCCGGATACGAGCGTGAGGTGGCATCGCTGCGCGAGGAGGTCAGCATGCTACGGCGCCGCGCAGAAGATGCG
TTGGAGCAAAAGTGGCAGGTGGAGAAGGGCCTGGGCGGTCTGAAGATGGATCTGGACCGCGCCGAGGAGGAGATTGCAAG
CCTGCGCAAGATGCTGCAGCAGAGCGACATCCTGATCACGCCCTCCAGCCGCGTGGTGTCTATGGCATCGGGCGACTTGG
ACGCGAATGCCACACCTTCGGGACCAGCAACGTCGGCTTCGCTGGAGGCAGCGTATCGGAACCTGCAGACATACTACAAC
GAGGCGCTAGAGCGTATCCGGGCGCTGGAGATCTCGGCGTCCGACGGCACGATCGTTGCGGCCATGGCAGACGAGAAGAC
GGCGATGGCCATTCGGCGTCTGGAGCAGGCACTAGCCGGAGCCGTGGCAGACCGAGATGCAGCCCAGAGCCAGTTGGCGG
ATGCGGCGGCTGCGGAGGCTTCGCTGATGGCGAGCGAGCGCAATCTGGCGGAGCAGCTGGACGCTTCAGCAGAGCGGGTG
ACAGATTTGGCACAGCAGGTGCAGGAACAGCTCTCGACCAACGCGCTGCTGCGCGAGCGGCTGACAACGATGGTGGCTCG
ACGAGAGTCGGAGCAGCGATTCAACAAGGAGCGCATTGTTGGTCTGGAGGCACGGCTGCGCACGCTCGAGGAGCAGCTGG
TGGCGACGCAGACGGCAGCGGAAGACGGCGTGTCGCGGCACGAGGAGCAGGTGGCAGCGCTGCGGGAGGCACACTCGTCG
CAGCTGCAGCGGCTGCGCGACGCGTCAGGCCAATTACGGGCGCCACCATCGTCGCCGCGAGCCGGAGCTGGACTGGTATC
ACCGCGATTCTTCGCGGGTAACGGCGGGTTGAAGTCGCCGTTGTCGCCGATGTTTGCCATCAACGGACGGCTGGTGCCAT
CACGGCCGAGCAGCCGGAACAGCATTTCCGGTGCAGGGACGGGATCGGGCGGACGAGCATCGCCGACGGTCGAGGCCGAC
CAGCAGATGCAGGTGTCGACTCTGCGGGCACGCGTGGGCGAGCTGGAGGGAGCGCTGGCGTCGGCCGACAGCGAGCTGCA
GGAGGTGGTGGGTCGGATGAACACGGCCCAGATCGAGGTGCTGCAGCTGCAGGAAGAGCGGGAGCAGGCTGCTCGGGAGA
CGCGGAAGTTGCAGCAGCTGCTGGAGGCCGAGCAGATCAAGCACTTTGAGGAGCGGTTCCGGTCGTTGGGAAGGATCTCC
ACGATGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62