GenePrediction:GLEAN_2782 Details

Name: GLEAN_2782
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3212038..3213685 (+ strand)
Length: 1648
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3212038..3212157 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:3212235..3212299 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_140:3212356..3213685 (+ strand)
Length: 1330
>GLEAN_2782 class=GenePrediction position=GCSC_140:3212038..3213685 (+ strand)
ATGGCTGTCATCGACGGCATCGACCTCGACGCCCTCGATTACGTTATCAAGGTCCCGTACAATGGCACCGGCGCAACCGG
TGGCGACTCCTTGACGGAGAACCTCAACATCTGGTACGAGGTAGGCATCTCGGGCCGACGGGCCCTGCCACCATGCACAA
TGCGTATCTGGCAACGGGAATACTGACAGGCACACAGAGCGGCGATATCGGCTGGATGATCACGGCCACGGCCCTCGTCC
TGCTCATGATTCCGGGTGTCGGGTGAGTTGCAGCGCAAAGGGCGCATTCGTTCGTGTGTACACGCTGACACCCGCCAGAT
TCTTCTACTCCGGCCTGGCCCGGAGAAAGTCGGCCCTCTCGCTGGTCTGGCTGTCGGTCATGGCCACAGCCGTCACGACG
TTCCAGTGGTTTTTCTGGGGCTATTCGCTTACCTTCTCGCACACGGCCAGCTCGTTCATGGGCAACCTGCACAACTTTGG
CTTCCGGGGCGTGCTGGCCCAGCCGTCGGTAGGATCGTCGCGCATTCCGGACATTCTGTTTGCCGTGTACCAGGGTATGT
TCTCGGCCATCACGGTAGCCTTAGCCACAGGCGCAGTAGCTGAGCGAGGCCGCATGCTGCCGTGCGTGATCTTCATGTTT
GTGTGGGCCACGGTGATCTACGACCCGATCGCCTGCTGGACCTGGAATCCGCACGGCTGGACGAGCAAGCTGGGTGGCCT
GGACTTTGCCGGCGGCACGCCTGTGCACATTGCCTCGGGCACGGCCGCGCTGGCCTACTCGATGATGCTGGGCAAGCGAC
GCGGCCACGGCACGCACGAGCTCAACTACCGTCCGCACAACGTCACGCATATCGTCATCGGCACGGTCTTCCTCTGGGTC
GGCTGGTTCGGCTTCAACGCCGGTTCGGCGCTGTCGGCCAACATCCGTGCCGTCATGGCCGCCATGGTGACGAACCTGGC
AGCGTGTGTGGGCGGGATCACGTGGTGTGTGCTTGACTACCGGCTAGAGCGCAAGTGGTCTACTGTCGGCTTCTGCTCGG
GCGTCGTGGCCGGACTGGTGGCCATCACGCCTGGCTCGGGCTACGTGCCGGTCTGGGCGGCCGTGCCGTACGGCGTGCTC
GGCGCAGCCTTTGCCAACTACGGCACCAAGCTCAAGTTCATTCTCGGGATCGACGACGCGCTCGACATCTTTGCTGTGCA
CGGCATCGGCGGTCTTGTCGGCAATGTGTGCACGGCCTTTTTCGCGGCCGACTACATTGCCCATCTGGACGGCGTGCAGG
TCATTCAGGGCGGCTGGATCAACCACCATTGGGTGCAGCTGGCCATCCAGCTGGCCGACTCCTTTTCTGGTGGCTGCTAC
TCCTTTGTCGGCACCTGCATCATCCTCTTCGTCATGAACATGATTCCCGGGCTGCATCTGCGGGCCAGCGAGGAGGCCGA
GATTCTTGGTATCGACGACGCCGAGATTGGCGAGTTCGCCTACGACTATGTCGAGCTGACCCGCGAGGTCCTCAACGAGG
TCGACAACGAGAACGGCTCCATGTTCTCCAACGACGCCATGACTGGCTATCCGCCCGCCCCCGAGAAGAACAGCATCCCG
CTGCGCGACGCCCGCATGTTCTCCGGCCAGTCGTCGTATGCGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62